Skip to main content
. 2011 Jul 21;10:55. doi: 10.1186/1475-2859-10-55

Table 2.

Strains, plasmids and primers used in this study

Materials Relevant features Source or reference
Strains
L. reuteri
JCM1112
Type strain, synonymous to ATCC 23272, DSM 20016 and F275. Human isolate. Japanese Collection of Microorganisms (Riken, Japan)
L. reuteri
ATCC PTA 6475
Synonymous to MM4-1A. Finnish mother's milk isolate. Biogaia AB (Stockholm, Sweden)
6475::pocR EmR, pocR insertion mutant derivative of L. reuteri ATCC PTA 6475 This study
Lc. lactis
NZ9000
MG1363 pepN:nisRK, cloning host. NIZO culture collection (Ede, The Netherlands)
L. delbrueckii
NIZO235
L. delbrueckii subsp. lactis ATCC 7830. Vitamin B12 assay indicator strain. NIZO culture collection (Ede, The Netherlands)

Plasmids
pCR®2.1 Used in routine cloning and to construct pJKS100 Invitrogen (Carlsbad, CA)
pLEM5 L. reuteri replication origin used to construct pJKS100 [28]
pNZ7021 CmR, pNZ8148 derivative with the nisin promoter replaced by the pepN promoter [23]
pNZ7748 CmR, pNZ7021 derivative harboring lreu_1750 downstream of the pepN promoter. This study
pVE6007 CmR, repA-positive temperature-sensitive derivative of pWV01 [27]
pORI28 EmR, repA-negative derivative of pWV01 [35]
pORIpocR EmR, pORI28 derivative harboring internal fragment of gene encoding putative PocR This study
pJKS100 CmR, E. coli-L. reuteri shuttle vector This study
pJKS101 CmR, pJKS100 derivative expressing 6475 pocR gene under control of its natural promoter This study

Primers 5' - 3' Application
P180 AAAAGGTACCGTAGGCGAAATTCAAATGTACG Amplification of lreu_1750 and addition of KpnI site
P181 GAATAAATAAGAGGCTGGGCAC Amplification of lreu_1750
P182 ATGAACTCTATTCAGGAATTG Control of pNZ7748
LR0062F-BHI TGACGGATCCTAACACAAGCATTACCGGAGCAATTG Amplification of internal fragment of putative pocR, addition of BamHI site and translational stop codon
LR0062R-ERI TGACGAATTCGCGTCTGATTCTATATGTGATTC Amplification of internal fragment of putative pocR and addition of EcoRI site
LR0062 FL F CGCTTTATCCTCAATTTGTTACG Amplification of wild-type pocR gene and natural promoter
LR0062 FL R GCTTTTACCATTGCATCAGCAG Amplification of wild-type pocR gene and natural promoter