Table 2.
Primers used in the studya
| Primer | Sequence (5′–3′) | Application |
|---|---|---|
| p1 | TACAAGCTTGAAGCCTGATA | Screening for erm(42) |
| p2 | TCCTTATCTGCCGTTTATCT | Screening for erm(42) |
| p3 | ATGCATATGAATAAAAACACT | 5′-end erm(42) with NdeI site (underlined) |
| p4 | GTTTATGGATCCTCTGTTAT | 3′-end erm(42) with BamHI site (underlined) |
| p35 | CAAGAGCTAAACAGGAGTAAA | Screening for msr(E) and mph(E) |
| p36 | TATTTGCAACAGTGCCTCAG | Screening for msr(E) and mph(E) |
| p37 | CAGGAGTAAATACATATGAGTT | 5′-end msr(E) with NdeI site (underlined) |
| p38 | CGGATAAGCTTGGCTATCAT | 3′-end msr(E) with HindIII site (underlined) |
| p39 | GGAAATTACATATGACAATTCAA | 5′-end mph(E) with NdeI site (underlined) |
| p40 | GTGCCTAAGCTTTCATATTTTT | 3′-end mph(E) with HindIII site (underlined) |
| p62 | TTAGTCCAACTTTTGGGGTG | Mapping contig assembly |
| p63 | AGGATTAACAACGCGTAAGC | Mapping contig assembly |
| p74 | GCTTGAGATAGACTAAACCC | Mapping contig assembly |
| p75 | CGCTAAGAATCCATAGTCCA | Mapping contig assembly |
| p82 | CAAGGACATACTGGGTTGAA | Determining chromosome integration site of exogenous sequence |
| p83 | GGATTGACCATCATTGGTTG | Determining chromosome integration site of exogenous sequence |
a
Primers were used for PCR and Sanger sequencing to verify the exogenous DNA structure in the 3361 genome and for cloning of the erm(42), msr(E), and mph(E) genes to construct E. coli recombinants.