Table 1.
Primers used for amplification of the genome of PRRSV HuN4-F112.
| Primera | Sequencesb (5'-3') | Position in HuN4 |
|---|---|---|
| For fragment A | ||
| F16(sp6) | CCGCTCGAGTTAATTAAATTTAGGTGACACTATAGGATGACGTATAGGTGTT | 1-16 |
| R2355 | GTGATGAACCTCGTCACCTTGTGCAGGG | 2355-2382 |
| For fragment B | ||
| F2300 | CTTTGGGCAAGGACTCGGT | 2300-2319 |
| R5914 | GATCCTGTGTGAACGCCGAC | 5914-5933 |
| For fragment C | ||
| F5853 | CTTCTGCTTCACCGCGTGT | 5853-5871 |
| R8825 | AAGAAGATTGGCGGCAAAC | 8825-8843 |
| For fragment D | ||
| F8764 | GCAGGTGCCTTGAAGCTGAT | 8764-8783 |
| R11910 | CTCATGCTGATGGCATTAGC | 11910-11929 |
| For fragment E | ||
| F11851 | AGGACTGGGAGGATTACAAT | 11851-11870 |
| R14670 | CGGACGACAAACGCGTGGTTAT | 14670-14691 |
| For fragment F | ||
| F14668 | TGATAACCACGCGTTTGTCGTC | 14668-14689 |
| R15313 | TATAGCGGCCGCATTTAAAT(T)32AATTACGG | 15313-15320 |
a Primer names are organized in groups. Prefixes: F, forward PCR primer; R, reverse PCR primer.
b The SP6 RNA polymerase promoter sequence in primer F16 is shown in italics. Restriction sites introduced by PCR are underlined and specified in parentheses at the end of the sequence. Silent mutations within the viral sequence are shown in boldface. Fragments A through F correspond to the letters in Fig. 1.