Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for cloning the Prl5a1 5′-flanking region
| Primer | Amplicon | Primer Sequence |
|---|---|---|
| Prl5a1-953 forward (−5048) | −5048 to +63 | AGTGGAGACTCCCAGCTCAA |
| Prl5a1-6063 reverse (+63) | −5048 to +63 | AGGGATGTGGTTGAATCTGC |
| 2349XhoI-forward (−3650) | −3650 to +63 | GCTTGGTGGCACATCTCGAGACTT |
| 5050Xho-forward (−951) | −951 to +63 | GGGCTCTAAAGGCTCGAGGA |
| 6063NcoI-reverse (+63) | −3650 to +63 and −951 to +63 | CTTACAGGGCCATGGTTGAATCTG |
