Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for real-time quantitative PCR
| Gene name | Forward primer | Reverse primer |
|---|---|---|
| NT-PGClα | tgccattgttaagaccga | ggtcactggaagatatgg |
| Tfam | agccaggtccagctcactaa | aaacccaagaaagcatgtgg |
| NRF-1 | tggtccagagagtgcttgtg | ttcctgggaagggagaagat |
| Cyclophilin B | ccatcgtgtcatcaaggacttcat | cttgccatccagccaggaggtctt |
