. Author manuscript; available in PMC: 2012 Oct 19.

Published in final edited form as: J Am Chem Soc. 2011 Sep 22;133(41):16642–16649. doi: 10.1021/ja207086x

Table 4.

T_m, in vitro and in vivo activity of FHNA, HNA and LNA gapmer ASOs targeting mouse PTEN mRNA.

ASO^a	T_m (°C)^b vs	T_m (°C)^c vs	IC₅₀	ED₅₀	ED₅₀

	14-mer RNA	20-mer RNA	(μM)^d	(mg/kg)^e	(mg/kg)^f
FHNA A1	53.9	60.1	2.3	7.8	2.2
HNA A2	54.9	58.0	2.4	13.8	NT
LNA A3	61.1	65.4	1.5	7.2	2.1

Sequence used for evaluation ^mCTTAGCACTGGC^mCT; bold letters indicate modified residues in flanks and uppercase letters indicate 2′-deoxynucleotides in the gap; all linkages are phosphorothioate modified

Sequence of 14-mer RNA complement 5′-r(AGGCCAGUGCUAAG)-3′

Sequence of 20-mer RNA complement 5′-r(UCAAGGCCAGUGCUAAGAGU)-3′

IC₅₀ for PTEN mRNA reduction in mouse bEND cells with electroporation

Potency for PTEN mRNA reduction in mouse liver from single dose study

Potency for PTEN mRNA reduction in mouse liver from 3-week study