Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2011 Oct;134(2):151–160. doi: 10.1111/j.1365-2567.2011.03475.x

The Toll-like receptor 1/2 agonists Pam3CSK4 and human β-defensin-3 differentially induce interleukin-10 and nuclear factor-κB signalling patterns in human monocytes

Nicholas T Funderburg 1, Julie K Jadlowsky 2, Michael M Lederman 1,2, Zhimin Feng 3, Aaron Weinberg 3, Scott F Sieg 1,2
PMCID: PMC3194223  PMID: 21896010

Abstract

Human β-defensin 3 (hBD-3) activates antigen-presenting cells through Toll-like receptors (TLRs) 1/2. Several TLR1/2 agonists have been identified but little is known about how they might differentially affect cellular activation. We compared the effects of hBD-3 with those of another TLR1/2 agonist, Pam3CSK4, in human monocytes. Monocytes incubated with hBD-3 or Pam3CSK4 produced interleukin-6 (IL-6), IL-8 and IL-1β, but only Pam3CSK4 induced IL-10. The IL-10 induction by Pam3CSK4 caused down-modulation of the co-stimulatory molecule, CD86, whereas CD86 expression was increased in monocytes exposed to hBD-3. Assessment of signalling pathways linked to IL-10 induction indicated that mitogen-activated protein kinases were activated similarly by hBD-3 or Pam3CSK4, whereas the non-canonical nuclear factor-κB pathway was only induced by Pam3CSK4. Our data suggest that the lack of non-canonical nuclear factor-κB signalling by hBD-3 could contribute to the failure of this TLR agonist to induce production of the anti-inflammatory cytokine, IL-10, in human monocytes.

Keywords: antimicrobial peptides, defensins, monocytes, Toll-like receptors

Introduction

Human β-defensins (hBDs) have antimicrobial activity and also may provide signals to link innate and adaptive immune responses.1–4 Human β-defensins have chemotactic activity for immature dendritic cells, memory T cells and monocytes.2,5,6 We have recently shown that hBD-3 induces maturation of monocytes and myeloid dendritic cells through mechanisms dependent on Toll-like receptors (TLRs) 1 and 2.4

Activation of antigen-presenting cells (APCs) through TLRs typically results in the mobilization of the nuclear factor-κB (NF-κB) family of transcription factors. Comprising this family are: NF-κB1 (p50), NF-κB2 (p52), RelA (p65), RelB and c-Rel. As heterodimers or homodimers, these elements regulate transcription of genes that contain κB binding sites in their promoter/enhancer regions and thereby, induce the expression of inflammatory cytokines and co-stimulatory molecules.7–9 For example, p52 has been implicated in interleukin-10 (IL-10) induction whereas p65 is important in IL-1β and IL-6 production by APCs.10–13 Hence, differential activation of NF-κB transcription factors may determine the spectrum of cytokine expression and co-stimulatory characteristics of APC.

We demonstrate here that hBD-3 and another well-characterized TLR1/2 ligand, Pam3CysSerLys4 (Pam3CSK4), induce readily distinguishable patterns of protein expression in monocytes that are attributed to divergence of signalling pathway activation. Monocytes exposed to Pam3CSK4, but not to hBD-3, produce high levels of IL-10, which is dependent upon activation of the non-canonical (p52/NF-κB2) NF-κB pathway. As IL-10 has potent anti-inflammatory properties, the differential modulation of this cytokine by hBD-3 and other TLR1/2 agonists may have important consequences for immune function at mucosal sites.

Materials and methods

Reagents

Synthetic hBD-3 (shBD-3) was purchased from Peptides International (Louisville, KY) and Pam3CSK4 was obtained from EMC Microcollection (Tübingen, Germany). Complete medium consisted of RPMI-1640 (BioWhittaker, Walkersville, MD) supplemented with antibiotics (penicillin/streptomycin; BioWhittaker), 2 mm l-glutamine (BioWhittaker) and 10% human AB serum (Gemini Bioproducts, Woodland, CA). Interleukin-10 was obtained from Biolegend (San Diego, CA).

Cell preparation and culture

These studies were approved by the Institutional Review Board at Case Western Reserve University/University Hospitals/Case Medical Center. After informed consent was obtained, blood from 20 healthy donors was drawn into heparin-coated tubes. Peripheral blood mononuclear cells (PBMCs) were isolated over a Ficoll–Hypaque cushion. Monocytes were isolated using a magnetic antibody cell sorting monocyte isolation kit (Miltenyi Biotec, Bergisch Gladbach, Germany); purity of CD14+ cells was 90–95%. Three million PBMCs or purified monocytes were cultured in 1 ml medium with shBD-3 (20 μg/ml), Pam3CSK4 (50 ng/ml), or in medium alone for 18 hr. In some assays PBMCs were cultured with anti-IL-10 antibody (5 μg/ml; eBioscience, San Diego, CA), anti-TLR1/2 antibodies (GD2.F4 and TLR-2.5, 10 μg/ml), or mouse IgG1 (5 or 20 μg/ml, all from Invivogen, San Diego, CA) for 1 hr before addition of TLR agonists. The p38 inhibitor SB-203580, CCR2 chemokine receptor antagonist RS102895 hydrochloride, were purchased from Sigma Aldrich (St Louis, MO) and used at a concentration of 10 and 100 μm, respectively.

Flow cytometry

Cell surface molecules were stained with anti-CD14 conjugated with FITC or peridinin chlorophyll protein, anti-HLA-DR with allophycocyanin, anti-CD80 with phycoerythrin, CD86 with phycoerythrin-Cy5 or appropriate isotype control monoclonal antibodies (BD PharMingen, San Diego, CA). Cells were stained for 10 min in the dark at room temperature, washed, and analysed using an LSRII flow cytometer (Becton Dickinson, San Jose, CA) and analysed using facsdiva, (Version 6.1; BD Bioscience, San Diego CA) or flo-jo software (Tree Star Inc., Ashland, OR).

Cytokine bead array

Cytokines in cell supernatants were measured using the Human Inflammatory Cytokine Array capture beads as directed by the manufacturer (BD Bioscience).

Phospho-bead array

Levels of phosphorylated mitogen-activated protein kinases were measured using a BD Cytometric Bead Array and flex set beads for Phospho p38 (T180/Y182), Phospho c-Jun N-terminal kinase 1/2 (JNK1/2; T183/Y185) and phospho-extracellular signalling kinase 1/2 (ERK1/2; T202/Y204) (Becton Dickinson). Purified monocytes (2 × 106) were cultured in 1 ml of medium alone, or in medium supplemented with shBD-3 (20 μg/ml) or Pam3CSK4 (50 ng/ml) for 1 hr. Lysates were prepared as described in the manufacturer's instructions. Briefly, Denaturation Buffer was added to culture wells, lysates were boiled at 95° for 5 min, and frozen at −80°, until samples were thawed and phospho-proteins were measured using the flex set system and an LSRII flow cytometer. A standard curve of each of the phospho-proteins was generated and results were analysed using the fcap array software (v1.0.1; BD Biosciences).

Western blot analysis

Purified monocytes were cultured overnight at concentrations of 2·0 × 106 cells/ml and HEK293 cells were cultured overnight at concentrations of 1·0 × 106 cells/ml. They were then stimulated as above for 1, 2 or 3 hr; lysates were prepared and Western blot assays were performed using the methods previously described.4 Proteins were detected with primary monoclonal antibodies to NF-κB p100/52 (Cell Signaling Technology, Beverly, MA) or to the loading control, β-actin (Cell Signaling Technology). Secondary stains included anti-mouse or anti-rabbit horseradish peroxidase-conjugated antibodies (BioRad, Hercules CA).

Chromatin immunoprecipitation assay

Chromatin immunoprecipitation (ChIP) assays were performed as instructed by the EZ–Magna ChIP A kit (Millipore, Billerica, MA). Purified monocytes were incubated for 3 hr with either hBD-3 (20 μg/ml) Pam3CSK4 (50 ng/ml), or medium alone before cross-linking protein complexes to DNA using 1% formaldehyde (Sigma Aldrich). Samples were sonicated on ice (Sonicator 3000; Misonix, Farmingdale, NY) to generate DNA fragments. DNA was incubated with Protein A magnetic beads alone or with beads plus anti-p52 (sc-298; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or IgG isotype control antibody. The beads were pelleted with a magnetic separator (Magna Grip Rack; Millipore) and purified DNA was used in quantitative real-time PCR performed using FastStart Universal SYBR Green Master Mix (Rox) (Roche Diagnostics Corp., Indianapolis, IN) and primers specific for the IL-10 promoter (Right Primer: TGATTTCCTGGGGAGAACAG, Left Primer: CCCACCCCCTCATTTTTACT (Invitrogen, Carlsbad, CA).

Statistical methods

Cytokine levels and expression of CD86 in different culture conditions were compared using a Mann–Whitney U-test. Paired samples in the inhibitor and blocking antibody studies were compared using a Wilcoxon matched pairs test.

Results

Pam3CSK4, but not hBD-3, induces monocytes to express IL-10

To explore the characteristics of monocyte activation induced by hBD-3, we measured the levels of five different cytokines (IL-1β, IL-6, IL-8, tumour necrosis factor-α and IL-10) in supernatants of purified monocytes that had been cultured overnight in medium alone, or in medium supplemented with optimal concentrations of synthetic hBD-3 or Pam3CSK4. Exposure of purified monocytes to hBD-3 resulted in significant increases in the median levels of IL-8 (121·755 pg/ml) and IL-6 (6·118 pg/ml) compared with the levels of these cytokines from monocytes cultured in medium alone (55·470 pg/ml and 1·607 pg/ml, respectively, P < 0·05, N = 15; see Supplementary material, Table S1). Tumour necrosis factor-α was expressed by monocytes exposed to Pam3CSK4 in most experiments (7 of 10 experiments), while tumour necrosis factot-α induction was unusual in response to hBD-3 (levels greater than those found in unstimulated cell supernatants were seen in only 4 of 15 experiments). Most striking however, was the differential induction of IL-10. Whereas Pam3CSK4 consistently induced monocytes to express IL-10 (mean levels of 1·330 pg/ml, n = 10, P < 0·003, Fig. 1a), hBD-3 did not induce IL-10 expression to levels greater than those seen in medium alone (mean levels in medium alone = 126 pg/ml, with hBD-3 = 134 pg/ml, n = 15, P < 0·344). In contrast, nearly identical levels of IL-1β were induced by exposure of cells to hBD-3 or Pam3CSK4 (mean values, 1·176 and 1·312 pg/ml, respectively). Induction of IL-10 by Pam3CSK4 is dependent on TLR1 and TLR2 signalling; in six experiments, addition of monoclonal antibodies to these receptors resulted in a significant (65%, P < 0·05) inhibition of IL-10 induction in response to Pam3CSK4 (Fig. 1b). Addition of anti-TLR1/2 antibodies also inhibited induction of IL-1β by hBD-3 or Pam3CSK4 (% inhibition of 60% and 80%, respectively, n = 6, P < 0·05, Fig. 1c).

Figure 1.

Figure 1

Open in a new tab

Monocytes exposed to Pam3CSK4 and human β-defensin 3 (hBD-3) express interleukin-1β (IL-1β), but only monocytes exposed to Pam3CSK4 express IL-10. Purified human monocytes were cultured overnight in medium alone or in medium supplemented with hBD-3 (20 μg/ml) or Pam3CSK4 (50 ng/ml). Cytokines were detected in supernatants with cytokine bead array technology. (a) Exposure of cells to hBD-3 (n = 15 donors) or Pam3CSK4 (n = 10 donors) resulted in significant increases in mean levels of IL-1β production compared with levels produced by cells cultured in medium alone (P < 0·05). Monocytes exposed to Pam3CSK4 produced significantly more IL-10 than did cells cultured in medium alone and more than did cells cultured in medium supplemented with hBD-3 (P < 0·003, n = 10). Pre-incubation of monocytes with antibodies to Toll-like receptor 1 (TLR1) and TLR2 (10 μg/ml of each) 1 hr before stimulation with Pam3CSK4 results in inhibition of (b) Pam3CSK4 induced IL-10 production (P < 0·05, n = 6 donors) and (c) hBD-3 or Pam3CSK4 induced levels of IL-1β (P < 0·05, n = 6 donors).

The chemokine receptor CCR2 has been reported to be another potential receptor for hBD-3.14,15 To ensure that binding of hBD3 to CCR2 was not playing a role in the positive expression of IL-6, IL-8 or IL-1β, or the negative expression of IL-10, we pre-incubated PBMCs with an antagonist of CCR2 (RS102895, 100 μm), for 1 hr before exposing these cells to hBD-3 overnight. Addition of RS102895 did not inhibit hBD-3-mediated induction of IL-6, IL-8 or IL-1β (data not shown), nor did CCR2 antagonism result in induction of IL-10 by hBD-3 (n = 3; see Supplementary material, Fig. S1).

Monocyte expression of CD86 is differentially affected by hBD-3 and Pam3CSK4 and is related to differential induction of IL-10

Previous studies have shown that surface expression of the co-stimulatory molecule CD86 can be regulated by IL-10.16,17 We therefore measured CD86 expression on gated CD14+ monocytes within PBMC preparations cultured in medium alone, or in medium supplemented with hBD-3 or Pam3CSK4 (Fig. 2a). Expression of CD86 was decreased on monocytes exposed to Pam3CSK4 (13 of 18 donors) when compared with expression after culture in medium alone, with a mean decrease in staining intensity of 3926 light units when data from all subjects were analysed (n = 18). In contrast, exposure of PBMCs to hBD-3 consistently resulted in increased expression of CD86 on monocytes (in 18 of 18 donors and a mean increase of 13 048 light units, Fig. 2b).

Figure 2.

Figure 2

Open in a new tab

Induction of interleukin-10 (IL-10) by Pam3CSK4 results in decreased monocyte CD86 expression. Peripheral blood mononuclear cells (PBMCs) were cultured overnight in medium alone, or in medium supplemented with human β-defensin 3 (hBD-3; 20 μg/ml), Pam3CSK4 (50 ng/ml), or IL-10 (10 pg/ml to 10 ng/ml) and expression levels of CD86 were measured on gated CD14+ monocytes. (a) Representative histograms showing CD86 expression on monocytes cultured in medium alone, or on cells exposed to hBD-3 or Pam3CSK4. (b) Changes in CD86 expression from baseline levels after incubation with hBD-3 or Pam3CSK4. In these 18 experiments the differences in CD86 expression in these culture conditions were significant, P < 0·001. (c) Overnight exposure of whole PBMCs to IL-10 results in a dose-dependent decrease in monocyte CD86 expression, but not CD80 or CD14 expression. Data shown are mean values from three separate experiments using three different donors; error bars represent standard error. (d) Pre-incubation of PBMCs with an anti-IL-10 antibody results in inhibition of the shift in CD86 expression induced by Pam3CSK4 (n = 5 separate donors, P < 0·05). (e) Addition of IL-10 to human PBMC cultures stimulated by hBD-3 results in a dose-dependent decrease in CD86 expression; results shown are mean values with error bars representing standard error of the means of three separate experiments, each using a different donor.

To confirm that the down-modulation of CD86 expression on monocytes in response to Pam3CSK4 was a consequence of IL-10 induction, we performed the following experiments. Addition of IL-10 to PBMC cultures resulted in dose-dependent reduction in surface expression of CD86 on monocytes, but expression of CD14 and CD80 was not altered (Fig. 2c). Neutralization of IL-10 activity by addition of an anti-IL-10 monoclonal antibody prevented the decrease in CD86 expression induced by Pam3CSK4 (mean inhibition of 71%, n = 4, Fig. 2d). Furthermore, the addition of exogenous IL-10 to PBMCs cultured in the presence of hBD-3 resulted in a dose-dependent reduction of monocyte CD86 expression (Fig. 2e), implicating endogenous IL-10 as a key mediator of CD86 down-modulation.

The MAP kinase pathway is activated by both hBD-3 and Pam3CSK4

Signalling through branches of the mitogen-activated protein kinase pathway can result in expression of cytokines, such as IL-10.16,18–20 Activation of the p38 kinase is especially important for IL-10 induction.16,18,20 Purified monocytes were exposed to medium alone, or medium containing hBD-3 or Pam3CSK4 for 1 hr. Cells were lysed and levels of phosphorylated p38, JNK1/2 and ERK1/2 were measured by phospho-bead array. In three separate experiments, levels of phospho-p38 and phospho-ERK1/2 were increased in hBD-3 or Pam3CSK4 stimulated samples compared with levels in cells cultured in medium alone (Fig. 3a). Levels of phospho-JNK1/2 were increased only modestly by hBD-3 or Pam3CSK4 in these experiments. Interestingly, levels of phospho-p38 were similar in the hBD-3 and Pam3CSK4 cultures (mean Units/ml of p-p38 in medium-alone samples = 1876, hBD3 = 3112, Pam3CSK4 = 3922, n = 3). Addition of a chemical inhibitor of p38, SB203580, to PBMC cultures significantly decreased induction of CD86 on monocytes by hBD-3 (mean increase of 16 739 light units for hBD-3 alone and 3999 light units for hBD3+SB-203580, n = 7, P = 0·03, Fig. 3b), and increased levels of CD86 measured on monocytes exposed to Pam3CSK4 (mean decrease of – 1564 light units for Pam3CSK4 alone and an increase of 10 198 light units for Pam3CSK4 + SB203580, n = 7, P = 0·03, Fig. 3c). The increased surface expression of CD86 on monocytes exposed to Pam3CSK4 + SB is probably the result of inhibition of IL-10 production, as levels of IL-10 measured in supernatants from these samples were decreased compared with levels in samples that were exposed to Pam3CSK4 alone; although these differences did not reach statistical significance (mean 71·7 pg/ml, compared with 295·6 pg/ml, respectively, n = 5, P = 0·0625, Fig. 3d).

Figure 3.

Figure 3

Open in a new tab

Differential induction of interleukin-10 (IL-10) by human β-defensin 3 (hBD-3) and Pam3CSK4 is not likely to be caused by differences in mitogen-activated protein (MAP) kinase signalling. Purified human monocytes were cultured for 1 hr in medium alone or in medium supplemented with hBD-3 (20 μg/ml) or Pam3CSK4 (50 ng/ml). Cells were lysed and phospho-protein levels were measured. (a) Representative dot plot showing phosphorylated MAPKinase proteins. Cells stimulated with hBD-3 or Pam3CSK4 had increased levels of phospho-p38 (mean Units/ml in medium alone samples = 1876, hBD3 = 3112, Pam3CSK4 = 3922), ph-JNK1/2 (14·5, 22·7, and 29·5 Units/ml), and ERK1/2 (38·1, 706·9, and 594·9 Units/ml), n = 3 separate experiments, each with a different donor. (b) Peripheral blood mononuclear cells were pre-incubated with a p38 inhibitor (SB203580) for 1 hr and were then incubated overnight in medium alone, or in medium supplemented with hBD-3 (20 μg/ml) or Pam3CSK4 (50 ng/ml). Addition of SB203580 resulted in decreased surface levels of CD86 on monocytes exposed to hBD-3 and increased surface expression of CD86 on monocytes exposed to Pam3CSK4, compared with levels on cells incubated with either ligand alone (n = 7 separate donors, P = 0·03). (c) Inhibition of p38 results in decreased levels of IL-10 in the supernatants of cells exposed to Pam3CSK4 (n = 5 separate donors, P = 0·0625). Levels of IL-10 in medium alone samples did not exceed 17·3 pg/ml.

The alternative NF-κB pathway is activated by Pam3CSK4, but not by hBD-3

Induction of phospho-p38 was similar for monocytes stimulated with either hBD-3 or Pam3CSK4 so it was unlikely that signalling via p38 could explain differential induction of IL-10 by these molecules. We have shown previously that both hBD-3 and Pam3CSK4 could activate the canonical NF-κB pathway, but wanted to compare their effects on the non-canonical pathway, as the effects of LPS on IL-10 production have been linked to activation of this signalling cascade.4,13 Human monocytes were purified by negative selection and cultured for 2 hr in medium alone, or in medium supplemented with hBD-3 or Pam3CSK4. Western blot assays indicated that exposure of monocytes to Pam3CSK4 resulted in the apparent proteolysis of p100 into the active p52 product (Fig. 4a). Cells cultured with hBD-3 did not generate a p52 product above background levels. This finding in primary cells was confirmed using HEK cells engineered to express TLRs 1 and 2 (Fig. 4b).

Figure 4.

Figure 4

Open in a new tab

Activation of nuclear factor-κB (NF-κB) p52 is induced by Pam3CSK4, but not by human β-defensin 3 (hBD-3). (a) Purified human monocytes (three experiments with different donors) or (b) HEK293 cells expressing Toll-like receptor (TLR) 1 and 2 (three separate experiments) were incubated in medium alone or medium plus hBD-3 (20 μg/ml) or Pam3CSK4 (50 ng/ml) for 2 hr. Representative western blots for NF-κB p100/p52 are shown. (c) Exposure of purified monocytes to Pam3CSK4 results in binding of NF-κB p52 to the interleukin-10 (IL-10) promoter. Monocytes were stimulated with Pam3CSK4 or hBD-3, or left untreated for 3 hr. Total amplifiable IL-10 promoter DNA bound by p52 after chromatin immunoprecipitation is shown. Results represent the average of three determinations, normalized by subtracting values obtained from the no antibody control. Error bars indicate standard error of the mean. Immunoprecipitation with IgG isotype control antibodies resulted in low levels of amplifiable DNA, similar to levels observed with beads alone (not shown).

To confirm these observations and to assess interactions of NF-κB p52 with the IL-10 promoter we performed ChIP assays. Purified monocytes were cultured in medium alone or in medium containing hBD-3 or Pam3CSK4 for 3 hr. In three experiments, increased recruitment of the p52 subunit to the IL-10 promoter was observed in monocytes exposed to Pam3CSK4, while p52 recruitment to the IL-10 promoter was much lower in monocytes cultured in the presence of hBD-3 and comparable to that observed in monocytes cultured in medium alone (Fig. 4c).

Exposure of monocytes to hBD-3 and Pam3CSK4 concurrently results in enhancement of IL-1β but not IL-10 production

Since hBD-3 and Pam3CSK4 mediated different effects on cytokine production in a TLR1/2-dependent manner, we examined the effects of concurrent exposure to these molecules on cytokine production. Peripheral blood mononuclear cells were exposed to hBD-3, Pam3CSK4, or the combination of hBD-3 and Pam3CSK4 in overnight cultures and levels of IL-10 and IL-1β were measured in the supernatants. The addition of hBD-3 to Pam3CSK4-treated cells resulted in a significant dose-dependent enhancement of IL-1β levels in cell culture supernatants (Fig. 5a,b). The marked increases in levels of IL-1β induced by the combination of hBD-3 and Pam3CSK4 suggested that the activity of these molecules was synergistic rather than simply additive.

Figure 5.

Figure 5

Open in a new tab

Exposure of monocytes to human β-defensin 3 (hBD-3) and Pam3CSK4 concurrently results in enhancement of interleukin-1β (IL-1β), but not IL-10, production. Peripheral blood mononuclear cells (PBMCs) were cultured overnight in medium alone, or in medium supplemented with hBD-3 (20 μg/ml), Pam3CSK4 (50 ng/ml), or a combination of hBD-3 and Pam3CSK4 and levels of IL-1β and IL-10 were measured in the supernatants. (a) The combination of hBD-3 and Pam3CSK4 enhances IL-1β production in a synergistic manner (P < 0·003, n = 13 donors), (b) and this effect is dependent upon the amount of hBD-3 added (each line represents a separate donor, n = 3). (c) The combination of hBD-3 and Pam3CSK4 has no effect on IL-10 production compared with production when cells are stimulated by Pam3CSK4 alone (P = 0·3, n = 13 donors). (d) IL-10 levels were not significantly altered by any concentration of hBD-3 tested (lines represent separate donors, n = 3).

Unlike the effects on IL-1β production, adding hBD-3 to cell cultures had no effect on IL-10 production induced by Pam3CSK4 alone (Fig. 5c, P = 0·3, and Fig. 5d). These observations suggest that hBD-3 and Pam3CSK4 do not compete directly for TLR1/2 receptor occupancy and demonstrate that hBD-3 does not actively suppress IL-10 production resulting from TLR1/2 receptor signalling.

Discussion

These results emphasize the pivotal role of NF-κB signalling pathways in modulating APC activation and also demonstrate that two TLR1/2 agonists can differentially activate these pathways to result in clearly distinguishable biological effects. Activation of the canonical (p65/RelA) pathway results in the induction of inflammatory cytokines, such as IL-1β; whereas activation of the non-canonical (p100/p52) pathway is important for induction of IL-10 expression.10,11,13 Previous reports have also demonstrated that other members of the NF-κB family can positively (NF-κB p100/p50)21,22 and negatively (c-Rel)23,24 regulate IL-10 production, whereas studies of RelB knock-out mice suggest that this NF-κB member is not involved in IL-10 regulation.25 In the present study, we found that exposure of human monocytes to Pam3CSK4, but not to hBD-3, results in activation of the non-canonical NF-κB pathway and in binding of p52 to the IL-10 promoter. Our results provide an explanation for differential induction of IL-10 by hBD-3 and Pam3CSK4, although it is important to note that we have not excluded a possible role of other NF-κB signalling components.

While p38 signalling is also important in IL-10 induction,16,18 hBD-3 and Pam3CSK4 induced similar levels of phospho-p38, suggesting that p38 signalling is not a key mediator in differential IL-10 induction in this setting. The activation of p38 following TLR signalling is thought to occur downstream of TRAF6 activation and probably represents a divergent branch point from non-canonical NF-κB signalling that may arise downstream of TRAF3 signalling. Bone-marrow-derived macrophages with a Traf3−/− genotype are unable to produce IL-10 in response to TLR4 engagement.26 TRAF3/NIK27–30 or possibly PI3Kinase/Akt,31,32 are thought to be activated by TLR signalling, and could therefore potentially represent upstream pathways that may be linked to differential signalling by hBD-3 and Pam3CSK4.

One explanation for the differential induction of signalling molecules by hBD-3 and Pam3CSK4 may be related to how these molecules interact with the TLR1/2 receptor complex. This is plausible because earlier work has described distinct signalling cascades downstream of TLR4 as a result of activation by LPS and its derivative monophosphoryl lipid A.33 As the combination of hBD-3 and Pam3CSK4 resulted in enhanced IL-1β production, and had no effect on IL-10 expression, we suspect that if direct interactions are occurring between hBD-3 and TLR1/2, the binding sites are likely to be different from those described for Pam3CSK4.34–36 Moreover, the role of co-receptors in these activation processes may add further complexity. For example, several TLR1/2 co-receptors, including CD36 and GD1a, have been identified.37–39 Thus, the TLR1/2 co-receptor complex required to recognize hBD-3 and Pam3CSK4 could be different and could influence downstream signalling. Studies aimed at identification of co-receptors important for TLR1/2 recognition of hBD-3, as well as the hBD-3 binding sites on TLR1/2 itself, are currently being explored.

Overall, our findings suggest that two seemingly unrelated molecules, a triacylated lipopeptide and a cationic antimicrobial peptide, can also activate discreet signalling pathways downstream of the same TLRs. An alternative explanation is that hBD-3 or Pam3CSK4 may interact with additional unknown receptors to mediate their distinct effects. This seems a particular possibility for hBD-3, because this molecule has promiscuous receptor interactions, with the potential to associate with CXCR4, MC1R, CCR2, and perhaps with CCR6, as well as with other cell surface molecules not yet identified.5,14,15,40–42 We think CCR2 is an unlikely candidate, because antagonism of this receptor with RS102895 did not inhibit cytokine production from cells stimulated by hBD-3 and blockade of CCR2 did not result in hBD-3-induced expression of IL-10.

Differential modulation of IL-10 expression by microbial products or host factors able to interact with TLRs could play an important role in the development of inflammation and adaptive immunity. The induction of IL-10 by microbial products might provide a mechanism to dampen immune responses that could be important in homeostasis of the host with commensal organisms, but may also provide a mechanism of immune evasion for pathogens. The potential significance of IL-10 for pathogen invasion is highlighted by Epstein–Barr virus, which encodes a homologue of IL-10 to convey a survival advantage.43 Our data suggest that by avoiding induction of the immunoregulatory molecule, IL-10, hBD-3 may tip immune responses towards a pro-inflammatory environment that would potentially be more conducive to adaptive immune responses. The IL-10 that is produced in response to TLR agonists could also play an important role in APC maturation because we demonstrate here that this cytokine is both necessary for and sufficient to cause down-modulation of CD86 expression on these cells.12,16,17,44,45 Expression of CD86 has important implications for APC function. Blocking CD86 with antagonistic antibodies results in significant decreases in proliferation and cytokine production by T cells responding to antigen or mitogen and causes greater inhibition of T-cell function than does blockade of CD80 co-stimulation.17,46,47 Furthermore, blockade of CD86 may increase numbers of CD4+ CD25+ T regulatory (Treg) cells during induction of immune responses in vivo.48 Hence, by increasing the surface expression of CD86, hBD-3 may be enhancing the ability of APCs to prime productive T-cell responses while also steering responder T cells away from a Treg-cell phenotype.

The differential activities of hBD-3 and Pam3CSK4 that we have described here are not likely to be explained by dose-dependent effects. Lowering the concentration of Pam3CSK4, for example, leads to loss of IL-10 production and diminished down-modulation of CD86, but unlike stimulation with hBD-3, does not result in induction of CD86 expression at any concentration. We propose that the key determinant that distinguishes the activities of the TLR1/2 ligands hBD-3 and Pam3CSK4 rests in their distinct modulation of NF-κB signalling pathways.

The utility of TLR ligands as vaccine adjuvants is being investigated intensively. Some TLR ligands, including certain TLR2 agonists, have been shown to induce regulatory T-cell activity and this has been linked to IL-10 induction.12,49 Human BD-3 may be better suited as a vaccine adjuvant because it does not induce IL-10 production, although it still induces APC activation. Moreover, as hBD-3 is expressed by mucosal epithelial cells, strategies that induce endogenous hBD-3 expression may also promote enhanced vaccine responses at mucosal sites. By understanding the unique immunomodulatory and antimicrobial properties of hBD-3, we may ultimately be able to harness this molecule's full potential for clinical applications.

Acknowledgments

This work was supported in part by the Center for AIDS Research at Case Western Reserve University AI-36219 and by grants AI-71944, DE017335, PO1DE019759, and a grant from the James B. Pendleton Charitable Trust.

Disclosures

The authors have no competing interests.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Figure S1. Antagonism of CCR2 does not result in expression of interleukin-10 from human β-defensin-3-stimulated cells.

imm0134-0151-SD1.tif (2.9MB, tif)

Table S1. Summary of inflammatory cytokine induction by human β-defensin-3 and Pam3CSK4.

imm0134-0151-SD2.tif (349.9KB, tif)

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than about missing material) should be directed to the corresponding author for the article.

References

  • 1.Harder J, Bartels J, Christophers E, Schroder JM. Isolation and characterization of human β-defensin-3, a novel human inducible peptide antibiotic. J Biol Chem. 2001;276:5707–13. doi: 10.1074/jbc.M008557200. [DOI] [PubMed] [Google Scholar]
  • 2.Garcia JR, Jaumann F, Schulz S, et al. Identification of a novel, multifunctional β-defensin (human β-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 2001;306:257–64. doi: 10.1007/s004410100433. [DOI] [PubMed] [Google Scholar]
  • 3.Biragyn A, Ruffini PA, Leifer CA, et al. Toll-like receptor 4-dependent activation of dendritic cells by β-defensin 2. Science. 2002;298:1025–9. doi: 10.1126/science.1075565. [DOI] [PubMed] [Google Scholar]
  • 4.Funderburg N, Lederman MM, Feng Z, Drage MG, Jadlowsky J, Harding CV, Weinberg A, Sieg SF. Human β-defensin-3 activates professional antigen-presenting cells via Toll-like receptors 1 and 2. Proc Natl Acad Sci U S A. 2007;104:18631–5. doi: 10.1073/PNAS.0702130104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Yang D, Chertov O, Bykovskaia SN, et al. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science. 1999;286:525–8. doi: 10.1126/science.286.5439.525. [DOI] [PubMed] [Google Scholar]
  • 6.Wu Z, Hoover DM, Yang D, Boulegue C, Santamaria F, Oppenheim J, Lubkowski J, Lu W. Engineering disulfide bridges to dissect antimicrobial and chemotactic activities of human β-defensin 3. Proc Natl Acad Sci U S A. 2003;100:8880–5. doi: 10.1073/pnas.1533186100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Beinke S, Ley SC. Functions of NF-κB1 and NF-κB2 in immune cell biology. Biochem J. 2004;382(Pt 2):393–409. doi: 10.1042/BJ20040544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Ghosh S, Karin M. Missing pieces in the NF-κB puzzle. Cell. 2002;109(Suppl):S81–96. doi: 10.1016/s0092-8674(02)00703-1. [DOI] [PubMed] [Google Scholar]
  • 9.Kawai T, Akira S. Signaling to NF-κB by Toll-like receptors. Trends Mol Med. 2007;13:460–9. doi: 10.1016/j.molmed.2007.09.002. [DOI] [PubMed] [Google Scholar]
  • 10.Hayden MS, West AP, Ghosh S. NF-κB and the immune response. Oncogene. 2006;25:6758–80. doi: 10.1038/sj.onc.1209943. [DOI] [PubMed] [Google Scholar]
  • 11.Hiscott J, Marois J, Garoufalis J, et al. Characterization of a functional NF-κB site in the human interleukin 1 β promoter: evidence for a positive autoregulatory loop. Mol Cell Biol. 1993;13:6231–40. doi: 10.1128/mcb.13.10.6231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jarnicki AG, Conroy H, Brereton C, et al. Attenuating regulatory T cell induction by TLR agonists through inhibition of p38 MAPK signaling in dendritic cells enhances their efficacy as vaccine adjuvants and cancer immunotherapeutics. J Immunol. 2008;180:3797–806. doi: 10.4049/jimmunol.180.6.3797. [DOI] [PubMed] [Google Scholar]
  • 13.Caamano J, Tato C, Cai G, Villegas EN, Speirs K, Craig L, Alexander J, Hunter CA. Identification of a role for NF-κB2 in the regulation of apoptosis and in maintenance of T cell-mediated immunity to Toxoplasma gondii. J Immunol. 2000;165:5720–8. doi: 10.4049/jimmunol.165.10.5720. [DOI] [PubMed] [Google Scholar]
  • 14.Jin G, Kawsar HI, Hirsch SA, et al. An antimicrobial peptide regulates tumor-associated macrophage trafficking via the chemokine receptor CCR2, a model for tumorigenesis. PLoS ONE. 2010;5:e10993. doi: 10.1371/journal.pone.0010993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rohrl J, Yang D, Oppenheim JJ, Hehlgans T. Human β-defensin 2 and 3 and their mouse orthologs induce chemotaxis through interaction with CCR2. J Immunol. 2010;184:6688–94. doi: 10.4049/jimmunol.0903984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lim W, Ma W, Gee K, Aucoin S, Nandan D, Diaz-Mitoma F, Kozlowski M, Kumar A. Distinct role of p38 and c-Jun N-terminal kinases in IL-10-dependent and IL-10-independent regulation of the costimulatory molecule B7.2 in lipopolysaccharide-stimulated human monocytic cells. J Immunol. 2002;168:1759–69. doi: 10.4049/jimmunol.168.4.1759. [DOI] [PubMed] [Google Scholar]
  • 17.Mitra RS, Judge TA, Nestle FO, Turka LA, Nickoloff BJ. Psoriatic skin-derived dendritic cell function is inhibited by exogenous IL-10. Differential modulation of B7-1 (CD80) and B7-2 (CD86) expression. J Immunol. 1995;154:2668–77. [PubMed] [Google Scholar]
  • 18.Ma W, Lim W, Gee K, Aucoin S, Nandan D, Kozlowski M, Diaz-Mitoma F, Kumar A. The p38 mitogen-activated kinase pathway regulates the human interleukin-10 promoter via the activation of Sp1 transcription factor in lipopolysaccharide-stimulated human macrophages. J Biol Chem. 2001;276:13664–74. doi: 10.1074/jbc.M011157200. [DOI] [PubMed] [Google Scholar]
  • 19.Norkina O, Dolganiuc A, Shapiro T, Kodys K, Mandrekar P, Szabo G. Acute alcohol activates STAT3, AP-1, and Sp-1 transcription factors via the family of Src kinases to promote IL-10 production in human monocytes. J Leukoc Biol. 2007;82:752–62. doi: 10.1189/jlb.0207099. [DOI] [PubMed] [Google Scholar]
  • 20.Pilette C, Detry B, Guisset A, Gabriels J, Sibille Y. Induction of interleukin-10 expression through Fcalpha receptor in human monocytes and monocyte-derived dendritic cells: role of p38 MAPKinase. Immunol Cell Biol. 2010;88:486–93. doi: 10.1038/icb.2009.120. [DOI] [PubMed] [Google Scholar]
  • 21.Cao S, Zhang X, Edwards JP, Mosser DM. NF-κB1 (p50) homodimers differentially regulate pro- and anti-inflammatory cytokines in macrophages. J Biol Chem. 2006;281:26041–50. doi: 10.1074/jbc.M602222200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Waterfield MR, Zhang M, Norman LP, Sun SC. NF-κB1/p105 regulates lipopolysaccharide-stimulated MAP kinase signaling by governing the stability and function of the Tpl2 kinase. Mol Cell. 2003;11:685–94. doi: 10.1016/s1097-2765(03)00070-4. [DOI] [PubMed] [Google Scholar]
  • 23.Wang Y, Rickman BH, Poutahidis T, Schlieper K, Jackson EA, Erdman SE, Fox JG, Horwitz BH. c-Rel is essential for the development of innate and T cell-induced colitis. J Immunol. 2008;180:8118–25. doi: 10.4049/jimmunol.180.12.8118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Sanjabi S, Hoffmann A, Liou HC, Baltimore D, Smale ST. Selective requirement for c-Rel during IL-12 P40 gene induction in macrophages. Proc Natl Acad Sci U S A. 2000;97:12705–10. doi: 10.1073/pnas.230436397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Caamano J, Alexander J, Craig L, Bravo R, Hunter CA. The NF-κB family member RelB is required for innate and adaptive immunity to Toxoplasma gondii. J Immunol. 1999;163:4453–61. [PubMed] [Google Scholar]
  • 26.Hacker H, Redecke V, Blagoev B, et al. Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature. 2006;439:204–7. doi: 10.1038/nature04369. [DOI] [PubMed] [Google Scholar]
  • 27.Hauer J, Puschner S, Ramakrishnan P, Simon U, Bongers M, Federle C, Engelmann H. TNF receptor (TNFR)-associated factor (TRAF) 3 serves as an inhibitor of TRAF2/5-mediated activation of the noncanonical NF-κB pathway by TRAF-binding TNFRs. Proc Natl Acad Sci U S A. 2005;102:2874–9. doi: 10.1073/pnas.0500187102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.He JQ, Saha SK, Kang JR, Zarnegar B, Cheng G. Specificity of TRAF3 in its negative regulation of the noncanonical NF-κB pathway. J Biol Chem. 2007;282:3688–94. doi: 10.1074/jbc.M610271200. [DOI] [PubMed] [Google Scholar]
  • 29.Zarnegar BJ, Wang Y, Mahoney DJ, et al. Noncanonical NF-κB activation requires coordinated assembly of a regulatory complex of the adaptors cIAP1, cIAP2, TRAF2 and TRAF3 and the kinase NIK. Nat Immunol. 2008;9:1371–8. doi: 10.1038/ni.1676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tseng PH, Matsuzawa A, Zhang W, Mino T, Vignali DA, Karin M. Different modes of ubiquitination of the adaptor TRAF3 selectively activate the expression of type I interferons and proinflammatory cytokines. Nat Immunol. 2010;11:70–5. doi: 10.1038/ni.1819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Guha M, Mackman N. The phosphatidylinositol 3-kinase-Akt pathway limits lipopolysaccharide activation of signaling pathways and expression of inflammatory mediators in human monocytic cells. J Biol Chem. 2002;277:32124–32. doi: 10.1074/jbc.M203298200. [DOI] [PubMed] [Google Scholar]
  • 32.Gustin JA, Korgaonkar CK, Pincheira R, Li Q, Donner DB. Akt regulates basal and induced processing of NF-κB2 (p100) to p52. J Biol Chem. 2006;281:16473–81. doi: 10.1074/jbc.M507373200. [DOI] [PubMed] [Google Scholar]
  • 33.Mata-Haro V, Cekic C, Martin M, Chilton PM, Casella CR, Mitchell TC. The vaccine adjuvant monophosphoryl lipid A as a TRIF-biased agonist of TLR4. Science. 2007;316:1628–32. doi: 10.1126/science.1138963. [DOI] [PubMed] [Google Scholar]
  • 34.Jin MS, Kim SE, Heo JY, Lee ME, Kim HM, Paik SG, Lee H, Lee JO. Crystal structure of the TLR1-TLR2 heterodimer induced by binding of a tri-acylated lipopeptide. Cell. 2007;130:1071–82. doi: 10.1016/j.cell.2007.09.008. [DOI] [PubMed] [Google Scholar]
  • 35.Liang S, Hosur KB, Lu S, Nawar HF, Weber BR, Tapping RI, Connell TD, Hajishengallis G. Mapping of a microbial protein domain involved in binding and activation of the TLR2/TLR1 heterodimer. J Immunol. 2009;182:2978–85. doi: 10.4049/jimmunol.0803737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Omueti KO, Beyer JM, Johnson CM, Lyle EA, Tapping RI. Domain exchange between human toll-like receptors 1 and 6 reveals a region required for lipopeptide discrimination. J Biol Chem. 2005;280:36616–25. doi: 10.1074/jbc.M504320200. [DOI] [PubMed] [Google Scholar]
  • 37.Drage MG, Pecora ND, Hise AG, Febbraio M, Silverstein RL, Golenbock DT, Boom WH, Harding CV. TLR2 and its co-receptors determine responses of macrophages and dendritic cells to lipoproteins of Mycobacterium tuberculosis. Cell Immunol. 2009;258:29–37. doi: 10.1016/j.cellimm.2009.03.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Liang S, Wang M, Tapping RI, et al. Ganglioside GD1a is an essential coreceptor for Toll-like receptor 2 signaling in response to the B subunit of type IIb enterotoxin. J Biol Chem. 2007;282:7532–42. doi: 10.1074/jbc.M611722200. [DOI] [PubMed] [Google Scholar]
  • 39.Rahaman SO, Lennon DJ, Febbraio M, Podrez EA, Hazen SL, Silverstein RL. A CD36-dependent signaling cascade is necessary for macrophage foam cell formation. Cell Metab. 2006;4:211–21. doi: 10.1016/j.cmet.2006.06.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Candille SI, Kaelin CB, Cattanach BM, et al. A β-defensin mutation causes black coat color in domestic dogs. Science. 2007;318:1418–23. doi: 10.1126/science.1147880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Feng Z, Dubyak GR, Lederman MM, Weinberg A. Cutting edge: human β defensin 3 – a novel antagonist of the HIV-1 coreceptor CXCR4. J Immunol. 2006;177:782–6. doi: 10.4049/jimmunol.177.2.782. [DOI] [PubMed] [Google Scholar]
  • 42.Quinones-Mateu ME, Lederman MM, Feng Z, et al. Human epithelial β-defensins 2 and 3 inhibit HIV-1 replication. Aids. 2003;17:F39–48. doi: 10.1097/00002030-200311070-00001. [DOI] [PubMed] [Google Scholar]
  • 43.Moore KW, Vieira P, Fiorentino DF, Trounstine ML, Khan TA, Mosmann TR. Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein–Barr virus gene BCRFI. Science. 1990;248:1230–4. doi: 10.1126/science.2161559. [DOI] [PubMed] [Google Scholar]
  • 44.Liu G, Ng H, Akasaki Y, Yuan X, Ehtesham M, Yin D, Black KL, Yu JS. Small interference RNA modulation of IL-10 in human monocyte-derived dendritic cells enhances the Th1 response. Eur J Immunol. 2004;34:1680–7. doi: 10.1002/eji.200425081. [DOI] [PubMed] [Google Scholar]
  • 45.Igietseme JU, Ananaba GA, Bolier J, et al. Suppression of endogenous IL-10 gene expression in dendritic cells enhances antigen presentation for specific Th1 induction: potential for cellular vaccine development. J Immunol. 2000;164:4212–9. doi: 10.4049/jimmunol.164.8.4212. [DOI] [PubMed] [Google Scholar]
  • 46.Makrigiannis AP, Musgrave BL, Hoskin DW. Differential effects of B7-1 and B7-2 on the costimulation of mouse nonspecific cytotoxic T lymphocyte development in response to anti-CD3 antibody. J Leukoc Biol. 1999;66:792–802. doi: 10.1002/jlb.66.5.792. [DOI] [PubMed] [Google Scholar]
  • 47.Yi-qun Z, Joost van Neerven RJ, Kasran A, de Boer M, Ceuppens JL. Differential requirements for co-stimulatory signals from B7 family members by resting versus recently activated memory T cells towards soluble recall antigens. Int Immunol. 1996;8:37–44. doi: 10.1093/intimm/8.1.37. [DOI] [PubMed] [Google Scholar]
  • 48.Zhu XY, Zhou YH, Wang MY, Jin LP, Yuan MM, Li DJ. Blockade of CD86 signaling facilitates a Th2 bias at the maternal–fetal interface and expands peripheral CD4+ CD25+ regulatory T cells to rescue abortion-prone fetuses. Biol Reprod. 2005;72:338–45. doi: 10.1095/biolreprod.104.034108. [DOI] [PubMed] [Google Scholar]
  • 49.Dillon S, Agrawal S, Banerjee K, et al. Yeast zymosan, a stimulus for TLR2 and dectin-1, induces regulatory antigen-presenting cells and immunological tolerance. J Clin Invest. 2006;116:916–28. doi: 10.1172/JCI27203. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

imm0134-0151-SD1.tif (2.9MB, tif)
imm0134-0151-SD2.tif (349.9KB, tif)

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES