Table 1. Summary of probes introduced into FISH analysis.

Probesa	Sequences (5′– 3′)	Target nucleic acid	Aligned position
DNA-UniC-0512-A-18	GWATTACCGCGGCKGCTG	cytoplasmic SSU RNA	512–529
DNA-UniR-0499-S-18	CAGCMGCCGCGGUAAUWC
DNA -Pdon-0587(P. donghaiense)-A-22	TTTGGCACCTTGGAGATCTCGG	cytoplasmic LSU RNA	587–608
DNA -Pdon-0602(P. donghaiense)-A-23	ATCTCGGCTTGGCCTGCCACAGT	cytoplasmic LSU RNA	602–624
DNA-Pdon-0512(P. donghaiense)-A-19	CTTGTCTTCGGGTGAGTGA	cytoplasmic LSU RNA	512–530
DNA -Pdon-0443(P. donghaiense)-A-19	TCCTGATCGTCTCCTGCCT	cytoplasmic LSU RNA	443–461
DNA -Pdon-1704(P. donghaiense)-A-23	GGACCTGGACGAACGCCTTTCAA	cytoplasmic SSU RNA	1704–1726
DNA-Pdon-0159(P. donghaiense)-A-25	CCACTCAGAACAAATTGGAACATAC	nuclear ITS DNA	159–183
DNA-Pdon-0498(P. donghaiense)-A-21	GCCCGACAACAAGACAACAGA	nuclear ITS DNA	498–518
PNA -Pdon-0443(P. donghaiense)-A-19	TCCTGATCGTCTCCTGCCT	cytoplasmic LSU RNA	443–461

^aProbe names follow the nomenclature outlined by Wheeler Alm et al. [51], with little revision. The first four letters stand for the kind of probe; for example, PNA stands for PNA probe. The second four-letter code is for the target of the probe. The next number is the 5′ position of the probe relative to either Escherichia coli or target organism (P. donghaiense). The next letter is for whether the probe is identical to the DNA sense or antisense strand. The last number is the length of the probe.