Skip to main content
. 2009 Nov 6;1(2):74–99. doi: 10.3390/toxins1020074

Table 3.

Sclerotial, genetic, and toxin-producing characteristics of isolates of Aspergillus species.

Species Strain Sclerotial Morphotypea AF/CPA Productionb norB-cypA Patternc p450d
A. flavus CA28 S +/+ I N
CA42 S +/+ I N
CA43 S +/+ I N
CA44 S +/+ I N
AF12 S +/+ I N
AF70 S +/+ I N
GA10-18 S +/+ I N
VA4-36 S +/+ I N
AF13 L +/+ II N
CA14 L +/+ II N
CA19 L +/+ II N
GA9-9 L +/+ II N
GA13-9 L +/+ II N
NRRL3357 L +/+ II N
VA2-9 L +/+ II N
LA4-5 L −/+ I N
SC6-9 L −/+ I N
TX9-8 L −/+ I N
GA4-4 L −/+ II N
LA10-4 L −/+ II N
MS1-1 L −/+ I Y
NC3-6 L −/+ I Y
SC3-5 L −/+ I Y
TX21-9 L −/+ I Y
A. oryzae NBRC 4177 ? −/+ ? Y
RIB40 N −/− I Y
SRRC304 N −/? I Y
SRRC493 N −/? I Y
SRRC2044 N −/? I Y
A. parasiticus BN009 L +/− intact N
SRRC2043 L +*/− intact N
SRRC2999 L +/− intact N
A. sojae SRRC299 N −/? intact N
SRRC1123 N −/? intact N
SRRC1126 N −/? intact N

a: S and L indicate S-strain and L-strain isolates based on the size of sclerotia produced.

b: I and II indicate type I and type II deletions in the norB-cypA region.

c: The p450-specific oligonucleotides used in PCR, tgtgacggtggatggcgagc and tcaatggctttgtactccag, were derived from identical regions of A. oryzae RIB40 and Aspergillus SBG strain, BN008R.