. 2011 Nov;77(21):7823–7829. doi: 10.1128/AEM.05822-11

Table 1.

Oligonucleotides used in the study

Oligonucleotide name	Sequence (5′ → 3′)^a	Description
MC840	`gtatgcggccgctccacacacagtggaggg`	Amplification of the 5′ region of uhd1 for deletion construct
MC841	`cacggcctgagtggcctgtgagcagttgtacatgg`
MC842	`gtgggccatctaggcctcgtatagcaacggatgaaattcgtg`	Amplification of the 3′ region of uhd1 for deletion construct
MC843	`cacagcggccgccaagaatcgatgcttgccgg`
RB89	`gagccatggtaaaaatgacaaaggaagccg`	Amplification of fhd1 ORF
RB90	`gaggcggccgcgcccgcccgacgatagttat`	Amplification of fhd1 ORF
RB125a	`ccatggccacccagactctatc`	Amplification of ahd1 ORF
RB125b	`gcggccgctagccgtctggcccgaatac`	Amplification of ahd1 ORF
RB18	`agaggagtgaggcggtttgg`	Amplification of internal probe for gene fat2 (RT-PCR)
RB19	`caagagcccaacgctgaacg`	Amplification of internal probe for gene fat2 (RT-PCR)
RB27	`cctcctgctgctgctgctgc`	Internal control primers for fhd1
RB28	`gccattcgaagtgtacatgg`	Internal control primers for fhd1
RB72	`ccaacgtcttcttcgacatc`	Amplification of internal probe for gene ppi (RT-PCR)
RB73	`gcgccgtagatcgacttgcc`	Amplification of internal probe for gene ppi (RT-PCR)
RB112	`gcctcctcgccaccgaggtc`	Amplification of internal probe for gene ahd1 (RT-PCR)
RB113	`ggtgccgatgaggaggccgg`	Amplification of internal probe for gene ahd1 (RT-PCR)

Underlined letters indicate introduced restriction sites.