Table 2.
Enzyme | Gene Locus | Oligoprimer Sequence | Fold-of-Increase c |
---|---|---|---|
Primers used for 18S rDNA in qPCR are ttcctagcgagcccaacct and cccgccgaagcaactaag. | |||
a: Broad Institute Aspergillus Comparative Database gene accession number (http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHome.html); b: NCBI Entrez Gene accession number (http://www.ncbi.nlm.nih.gov/gene) (Table S1 and Table S2); c: Relative gene expression level ° S.D. The gene expression level of A. parasiticus BN9 is 1.00. | |||
superoxide dismutase | AFL2G_10810.2 a | cgccggtactgacgacctt | 2.09 ° 0.06 |
AFLA_099000 b | agcattgccagtcttcttgga | ||
catalase | AFL2G_05806.2 | caggtggcttcgcgtccta | 2.30 ° 0.13 |
AFLA_056170 | caggccgcgcttcttg | ||
cytochrome c peroxidase | AFL2G_04481.2 | tcggtcgtgcccatcct | 2.38 ° 0.12 |
AFLA_110690 | aagacagtagggctgaagttcca |