Table 2.

Expression of oxidative stress defense genes in A. parasiticus BN9∆msnA.

Enzyme	Gene Locus	Oligoprimer Sequence	Fold-of-Increase c
Primers used for 18S rDNA in qPCR are ttcctagcgagcccaacct and cccgccgaagcaactaag.
a: Broad Institute Aspergillus Comparative Database gene accession number (http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHome.html); b: NCBI Entrez Gene accession number (http://www.ncbi.nlm.nih.gov/gene) (Table S1 and Table S2); c: Relative gene expression level ° S.D. The gene expression level of A. parasiticus BN9 is 1.00.
superoxide dismutase	AFL2G_10810.2 a	cgccggtactgacgacctt	2.09 ° 0.06
	AFLA_099000 b	agcattgccagtcttcttgga
catalase	AFL2G_05806.2	caggtggcttcgcgtccta	2.30 ° 0.13
	AFLA_056170	caggccgcgcttcttg
cytochrome c peroxidase	AFL2G_04481.2	tcggtcgtgcccatcct	2.38 ° 0.12
	AFLA_110690	aagacagtagggctgaagttcca