Table 2.

The primers used for the generation of the three HCV Core/E1 datasets. The numbering of primer positions is according to HCV H77 strain (GenBank accession number AF009606). Degenerate bases are matched with standard International Union of Pure and Applied Chemistry (IUPAC) codes. RT, reverse transcription

Dataset	Primers	Polarity	Sequence (5′-3′)	Position	Application	Product size
1	987R_H77	Anti-sense	cgtaggggaccagttcatcatcat	1305–1328	RT/1st round PCR	474 bp
	493S_H77	Sense	gcaacagggaaccttcctggttgctc	834–859	1st round PCR
	502S_H77	Sense	aaccttcctggttgctctttctctat	843–868	2nd round PCR
	975R_H77	Anti-sense	gttcatcatcatatcccatgccat	1293–1316
2	CER1414	Anti-sense	cccrcsaggachccccagtg	1395–1414	RT/1st round PCR	596 bp
	CEF696	Sense	tgggtaaggtcatcgatacc	697–716	1st round PCR
	CEF723	Sense	gcggcttcgccgacctcatg	724–743	2nd round PCR
	CER1318	Anti-sense	ccagttcatcatcatrtccca	1299–1319
3	E4R	Anti-sense	gttggrctccarttcatcatc	1307–1327	RT/1st round PCR	469 bp
	Core823	Sense	ggatcaaytaygcaacaggg	823–842	1st round PCR
	Core850	Sense	ccggttgctcyttytctatc	850–869	2nd round PCR
	E2R	Anti-sense	cagttcatcatcatrtccct	1299–1318