Table 2.
Sequences of the six novel miRNAs identified in Clonorchis sinensis and their location within the published Schistosoma japonicum genome
| miRNA | Sequence (5'-3') | Size | Locia | Countb | ΔGc | Express leveld |
|---|---|---|---|---|---|---|
| cis-mir-001 | UGGAAAAGAGAUACGGCUGCU | 21 | 14 | 12 | -23.1 | 0.30 ± 0.07 |
| cis-mir-002 | CUGGUCAUCAUCAUCAUCAUA | 21 | 1 | 5 | -23.0 | 0.10 ± 0.02 |
| cis-mir-006 | UAUCACAGCCGUGCUUAAGGGC | 22 | 1 | 108 | -28.4 | 0.001 ± 0.00 |
| cis-mir-010 | UAUUAUGCAACGUUUCACUCU | 21 | 1 | 8 | -37.9 | 0.02 ± 0.01 |
| cis-mir-018 | GAGAGAUUUGUGGAUACCUU | 20 | 2 | 13 | -21.9 | 0.0005 ± 0.00 |
| cis-mir-019 | UAGAGGAAUUGACGGAAGGGCA | 22 | 1 | 5 | -19.9 | 67.32 ± 12.87 |
a Location number of the miRNA sequence with the published genome sequence of S. japonicum of LSBI, Shanghai.
b The number of each miRNA appeared in the clean reads.
c ΔG means the energy of pre-miRNA hairpin, kcal/mol.
d The expression levels of the six novel miRNA relative to actin gene, and the data represent the means and standard deviation (SD) for triplicate reactions independently.