Skip to main content
. 2010 Jun 24;9:163. doi: 10.1186/1476-4598-9-163

Figure 4.

Figure 4

TES methylation and expression in cell lines and xenografts. A. TaqαI digests of TES bisulfite-specific PCR products from cell lines HL60, K562, MOLT4, Raji and U937, and normal PBL. B. Amplification of cell lines and normal PBL samples cDNAs using primers specific for TES exon 3 (5' TGCAAGTGTGGCCAAGAAGAGC 3') and exon 6 (5' CAGCGTGATTCTTCACATAGCAGG 3') and β2-microglobulin (For: 5' GAGTATGCCTGCCGTGTG 3' and Rev: 5' AATCCAAATGCGGCATCT 3'); first strand cDNA, with (+) or without (-) Superscript III reverse transcriptase. TES expression levels relative to PBL expression after normalisation to β2-microglobulin were calculated using qRT-PCR and are shown. C. qRT-PCR was used to calculate TES expression levels in ALL xenografts relative to PBL expression after normalisation to β2-microglobulin expression. Methylation status was determined using CoBRA.