Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences
| Gene | Forward 5′–3′ | Reverse 5′–3′ |
|---|---|---|
| CD11b | ctgggagatgtgaatggag | actgatgctggctactgatg |
| GFAP | agggacaatctcacacagg | gactcaaccttcctctcca |
| IL-1β | gaagtcaagaccaaagtgg | tgaagtcaactatgtcccg |
| CX3CL1 | tccagggctgtccccgcaaa | acaggcaggcaagcaggcag |
| CX3CR1 | ttcctcttctggacgcctta | taaacgccactgtctccg |
| GAPDH | gtttgtgatgggtgtgaacc | tcttctgagtggcagtgatg |
| 18s | atggtagtcgccgtgccta | ctgctgccttccttggatg |
