Skip to main content
. Author manuscript; available in PMC: 2013 Feb 1.
Published in final edited form as: Cancer Lett. 2011 Oct 12;315(1):48–58. doi: 10.1016/j.canlet.2011.10.007

Table I.

Nanocapsule Characteristics and Information

Batch Shell Ligand Particle Size (nm)1 Zeta Potential (meV)2 Morphology3 Cargo4,5 Sequence
1 Tenfibgen (TBG)
27 kDa		 17.1 ± 0.9 −9.0 ± 4.4 Uniform, Single Capsules DMAT Not Applicable
2 Tenfibgen (TBG)
27 kDa		 15.6 ± 1.1 −7.7 ± 3.8 Uniform, Single Capsules DMAT Not Applicable
1 Tenfibgen (TBG)
27 kDa		 10.7 ± 0.8 −5.4 ± 5.8 Uniform, Single Capsules siCK2 auacaacccaaacuccacau (antisense/guide strand)
2 Tenfibgen (TBG)
27 kDa		 11.5 ± 1.13 −5.9 ± 5.7 Uniform, Single Capsules siCK2 auacaacccaaacuccacau (antisense/guide strand)
1

Mean ± SEM of the average elliptical diameter determined from AFM micrographs of 25 capsules from two different preparations after drying on mica at 0.5 ng/ml.

2

Average surface charge measured by DLS from two different preparations across a 20 volt potential in 1 mM KCl at 2 μg/ml. Data shown is the mean ± SEM of 15 independent measurements.

3

Morphology of all nanocapsules determined by visual AFM observation as uniform, single capsules.

4

TBG-siCK2 encapsulation 100% as measured by the Burton assay relative to unencapsulated OGN. Estimated 60 siRNA molecules per 12 nm nanocapsule.

5

TBG-DMAT stock 1.7 μM with incorporation of 0.08% as measured by stoichiometric analysis utilizing isotopic bromine neutron activation.