Abstract
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).
Full text
PDF
Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Erdmann V. A. Collection of published 5S and 5.8S RNA sequences and their precursors. Nucleic Acids Res. 1979 Jan;6(1):r29–r44. doi: 10.1093/nar/6.1.419-c. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hori H., Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. doi: 10.1073/pnas.76.1.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hori H., Osawa S., Murao K., Ishikura H. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. Nucleic Acids Res. 1980 Nov 25;8(22):5423–5426. doi: 10.1093/nar/8.22.5423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iwabuchi M., Ito K., Ochiai H. Characterization of ribosomes in the cellular slime mold, Dictyostelium discoideum. J Biochem. 1970 Oct;68(4):549–559. doi: 10.1093/oxfordjournals.jbchem.a129385. [DOI] [PubMed] [Google Scholar]
- Lu A. L., Steege D. A., Stafford D. W. Nucleotide sequence of a 5S ribosomal RNA gene in the sea urchin Lytechinus variegatus. Nucleic Acids Res. 1980 Apr 25;8(8):1839–1853. doi: 10.1093/nar/8.8.1839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peattie D. A. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. doi: 10.1073/pnas.76.4.1760. [DOI] [PMC free article] [PubMed] [Google Scholar]