Table 2. Primers designed for sequencing of the TGFBI gene.
Primer for exon | Forward | Reverse | Length (bp) |
---|---|---|---|
1 |
caggaggcctaagggaccta |
ctccatgctgcaaggttttt |
607 |
2 |
tcaattgcccatgtcaaaga |
gccctgaaaaatgtctccaa |
607 |
3 |
ccagttggttggctgtaggt |
gaggagcagctcaggaaatg |
514 |
4 |
ccccagaggccatccctcct |
ccgggcagacggaggtcatc |
358 |
5 |
ggcatgatgaatgggagtct |
gagaagcaggcacaaagagg |
579 |
6 |
tctccttgggccctctatt |
tcaggggaacctgctctatg |
416 |
7 |
aggaagaggaaaggcaggtt |
agcaacaggacaggatgacc |
532 |
8 |
agaaggcgaggaggatctg |
gtcacaacccacacatttgc |
527 |
9 |
tgactgttcccctgatgaca |
ttttggttgagctgagtgga |
434 |
10 |
ttggcagcttcacttggttt |
ttccttccttgtcagcaacc |
409 |
11 |
tcccagccttaataacccatc |
cttttccccatcccaagtct |
433 |
12 |
tccagtggcctggactctac |
gatgtgccaactgtttgctg |
337 |
13 |
tgctttgtgtcctctgacca |
catcctgggggtgagatatg |
402 |
14 |
ggcgacaagattgaaactcc |
cccaattcactctgcaatca |
405 |
15 |
tgtgcattcacctttcttgg |
agtgggagtggggagaagtt |
406 |
16 |
gtccacctgaaggcacactt |
ccaagtcaccctgctgttct |
393 |
17 | cacctgctatgtgcaggaga | ggctggattgcttgattcat | 532 |