Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jul 1.
Published in final edited form as: J Immunol. 2011 Nov 28;188(1):155–162. doi: 10.4049/jimmunol.1102042

Overexpression of the CTLA-4 isoform lacking exons 2 and 3 causes autoimmunity1

Sue M Liu *,2, Andrew P R Sutherland *, Zheng Zhang *, Daniel B Rainbow †, Francisco J Quintana *, Alison M Paterson ‡, Arlene H Sharpe ‡, Mohamed Oukka §, Linda S Wicker †, Vijay K Kuchroo *,3
PMCID: PMC3245861  NIHMSID: NIHMS336771  EMSID: UKMS37885  PMID: 22124121

Abstract

CTLA-4 is a potent inhibitor of T cell activation, primarily upon binding to its costimulatory ligands (B7.1 and B7.2) expressed on antigen presenting cells. However, variants of CTLA-4 can also function independently of B7 molecules. 1/4CTLA-4 is a highly conserved isoform encoded by exons 1 and 4 of the Ctla4 gene that lacks the ligand-binding domain as well as the transmembrane domains, and as yet, its function is not known. To investigate the function of 1/4CTLA-4, transgenic (Tg) mice overexpressing this variant were generated. Cytokine production by 1/4CTLA-4 Tg T cells was elevated compared to wild type T cells. The frequency of CD44high memory T cells in 1/4CTLA-4 Tg mice was increased and as the mice aged, the frequency further increased. 1/4CTLA-4 Tg mice >1 year old had increased expression of T cell activation markers and developed spontaneous autoimmunity, including elevated production of autoantibodies. In contrast to young 1/4CTLA-4 Tg mice, aged 1/4CTLA-4 Tg mice had elevated frequencies of Foxp3+ regulatory T (T-reg) cells but the T-reg cells from these mice were not able to inhibit colitis development. Collectively, these data suggest that the function of the 1/4CTLA-4 isoform is distinct from that of CTLA-4 in that it enhances T cell activation and promotes autoimmunity rather than inhibiting immune responses.

INTRODUCTION

CTLA-4 is a member of the CD28 family of costimulatory receptors and binds the same ligands as CD28, namely B7.1 and B7.2. In contrast to CD28, CTLA-4 is a potent negative regulator of T cell activation, and deletion of Ctla4 has profound effects on peripheral tolerance (1-3). CTLA-4-deficient mice develop massive inflammatory infiltrates and tissue damage in multiple organs and exhibit early lethality. Deletion of both B7.1 and B7.2 rescues CTLA-4-deficient mice from lymphoproliferative disease, indicating that hyperactivation of T cells in CTLA-4 KO mice is the result of unchecked CD28/B7 interactions in the absence of inhibitory signal via CTLA-4 (4).

CTLA-4 expression is induced upon T cell activation and constitutively expressed on T-reg cells (5, 6). CTLA-4 expression on natural T-reg cells is crucial for their suppressive function, as conditional deletion of CTLA-4 in Foxp3+ T-reg cells leads to a breakdown of peripheral tolerance and multi-organ tissue inflammation reminiscent of that in CTLA-4 KO (but slower in tempo) and scurfy mice carrying a Foxp3 gene mutation (7, 8). In addition, a recent study showed that silencing of the soluble form of CTLA-4 in T-reg cells impaired their suppressive activity (9). Due to its potent inhibitory effects, CTLA-4 is a target for therapeutic intervention. Antibody blockade of CTLA-4 can enhance anti-tumor immunity, as well as increase cell-mediated immunity, but also has been shown to cause autoimmunity (10-13). An anti-CTLA-4 mAb (Ipilimumab) was just approved by FDA for treatment of human melanomas (14).

Genetic linkage to a locus containing CTLA-4 and ICOS has been reported in multiple autoimmune diseases in mice and humans. These costimulatory receptors are encoded by genes in the type 1 diabetes susceptibility locus on chromosome 1, Idd5.1 (15, 16). In addition to full-length (fl)4CTLA-4, three other splice variants have been identified. In humans the genetic association of CTLA4 with autoimmunity correlates with differential expression of the mRNA encoding the soluble form of CTLA-4, which lacks the transmembrane domain encoded by exon 3, and in non-obese diabetic mice disease linkage is correlated to the mRNA and protein expression of ligand-independent CTLA-4 (liCTLA-4) (15, 16). liCTLA-4 lacks the ligand-binding Ig domain, and has been reported to be one of the genetic elements that determine susceptibility to diabetes in non-obese diabetic mice (16). CTLA-4 can also inhibit T cell activation independently of B7 ligation (17, 18), as liCTLA-4 can replace some of the functions of CTLA-4 and partially rescue CTLA-4-deficient mice from early lethality and lymphoproliferative disease (19). liCTLA-4 appears to aid in maintaining self-tolerance, however, this isoform is not expressed in humans. Another isoform of CTLA-4 lacks both the ligand-binding and transmembrane domains encoded by exons 2 and 3, respectively, and is thus named 1/4CTLA-4; this variant is conserved between mice and humans (16). However, the function of 1/4CTLA-4 in the immune system is not known.

To examine the function of 1/4CTLA-4, we generated Tg mice that constitutively overexpress this isoform in T cells. Overexpressing 1/4CTLA-4 i n T cells lead to accumulation of activated/memory T cells in the peripheral repertoire and development of autoimmunity. The breakdown in self-tolerance in these mice was associated with hyperactivity of activated/memory T cells together with reduced suppressive activity of Foxp3+ T-reg cells. We provide evidence that, in contrast to the immunosuppressive functions of flCTLA-4 and liCTLA-4, 1/4CTLA-4 enhances T cell responses, induces T cell hyperactivity and spontaneous autoimmunity.

MATERIALS AND METHODS

Mice and reagents

Thy1.1 congenic and RAG1-/- mice were purchased from Jackson Laboratories (Bar Harbor, ME). Generation of CTLA-4-/-, Foxp3.gfp KI reporter and 2D2 MOG35-55 TCR Tg mice have been previously described (1, 20, 21). 1/4Ctla4 cDNA was cloned into a pBluescript vector under the control of human CD2 promoter and enhancer regions. Linearized plasmids containing 1/4Ctla4 were injected directly into the pronuclei of fertilized oocytes from C57Bl/6 at the Brigham and Women's Hospital Transgenic Core Facility. All experiments were carried out in accordance with the guidelines of the Institutional Animal Care and Use Committee at Harvard Medical School (Boston, MA).

Beads for magnetic activated cell sorting (MACS) were purchased from Miltenyi Biotec. All flow cytometry reagents were purchased from Biolegend, except CD3-APC-cy7, which was purchased from BD Bioscience. Purified functional grade antibodies for cell culture were obtained from BioXCell.

T cell proliferation assays

Cells were cultured in DMEM containing 10% FCS and supplemented with 1mM sodium pyruvate, nonessential amino acids, L-glutamine, and 100 U penicillin/100 μg streptomycin per ml and 5 × 10-5 M 2-mercaptoethanol. T cell proliferation was assayed using whole spleen and lymph node (LN) cultures stimulated with either soluble anti-CD3 or MOG35-55 peptide, cultures were pulsed with 1 μCi/well of 3H thymidine (Perkin Elmer) after 48 h, and 3H thymidine incorporation was measured on d 3 using a β-counter scintillation counter (1450 Microbeta, Trilux, Perkin Elmer).

Assays using either MACS isolated CD4+ T cells or sorted T cell subsets were cultured in the presence of autologous CD4-depleted splenocytes as APCs, irradiated with 3300 rad. CD4+Foxp3/GFP-CD62Lhigh44low naïve and CD4+ Foxp3/GFP-CD44high memory T cells were highly purified by cell sorting using a FACSAria (BD Bioscience) after enrichment for CD4+ T cells by magnetic separation. Purified T cells were activated either with 1 μg/ml plate-bound anti-CD3 (clone 145-2C11) and 2 μg/ml soluble anti-CD28 (clone PV-1), or with 1 μg/ml soluble anti-CD3 in the presence of APCs.

Cell culture supernatants were collected after 48 h and cytokine concentrations were determined either by ELISA or cytometric bead array according to the manufacturer's instructions (BD Biosciences).

Real-time PCR

For PCR analysis, RNA was isolated with Trizol reagent or using RNeasy minikit (Qiagen), and cDNA was synthesized using the iScript kit (BioRad). Real-time PCR was performed on an ABI Systems 7500 Fast Taqman machine using specific Taqman probe sets purchased from Sigma. Primer probe sequences for detection of fl- soluble and liCTLA-4 were previously published (16); to detect the 1/4 CTLA-4 mRNA the following primers and probe were designed: Forward: tgccttctaggacttggcctt, reverse: gaggacttcttttctttagcttcagaga, probe: agccctgctcactcttcttttcatccca. Relative transcript expression, was normalized against β-actin or β2 Microglobulin transcript where Δ cycle threshold (CT) represents the difference in the CT values between the target gene and the housekeeping gene.

Parking experiments

CD4+ T cells were isolated by MACS from pooled spleen and LN cells from 2D2 mice and activated with MOG35-55 peptide in the presence of irradiated whole splenocytes from wild type mice. After the cells stop blasting (usually 3 d), they were rested for 2 d. Cells were washed to remove debris and adoptively transferred i.v. into Thy1.1 congenic mice. Mice were sacrificed after 10 wk and donor 2D2 cells were identified in the spleen and LNs by staining with CD4 and Thy1.2 antibodies for FACS analysis.

Antigen arrays

Sera were collected from 1/4CTLA-4 Tg and non-Tg littermates at various ages and hybridized onto glass chips spotted with a panel of self-antigens as previously described (22).

EAE disease models

Mice were immunized with MOG35-55 peptide emulsified in CFA (Sigma) containing 4 mg/ml Mycobacterium tuberculosis extract H37Ra (Difco) in 100 μl/mouse s.c. distributed between the two hind flanks and above the sternum on d 0. On d 0 and d 2, 100 μg of pertussis toxin (List Biological Laboratories) was given i.v. Mice were monitored daily and clinical scores were given as follows: 1, limp tail; 2, hind limb paresis; 3, hind limb paralysis; 4, tetraplegia; 5, moribund. Brains and spinal cords were harvested for histopathological analysis after 30 d. Pertussis toxin was not given to mice that were sacrificed 8 d post-immunization to investigate T cell responses. For spontaneous EAE, 1/4CTLA-4 Tg mice were intercrossed with MOG TCR 2D2 Tg mice and scored twice a week; incidence was noted when mice displayed clinical scores of 1 or higher. As well as brains and spinal cords, eyes and optical nerves were collected for histopathological analysis within a week after clinical signs of EAE were detected.

Colitis disease model

CD4+CD45RBhigh naïve T and CD4+GFP+ T-reg cells were purified by cell sorting after enrichment for CD4+ cells using anti-CD4 MACS beads from Foxp3.gfp KI mice. 2×105 CD4+CD45RBhigh cells were transferred into RAG1-deficient mice either alone or co-transferred with either T-reg cells (at 1:1 or 1:0.5 ratio, effector T cells:T-reg cells) i.p. Mice were weighed weekly after adoptive transfer.

Statistical Analysis

Statistical analysis was performed using unpaired, two-tailed Student T-tests and p < 0.05 were considered statistically significant. For spontaneous EAE incidence, Logrank tests were performed using GraphPad Prism.

RESULTS

Distribution and expression kinetics of CTLA-4 variants

CTLA-4 is upregulated upon T cell activation and constitutively expressed by T-reg cells, however, the expression pattern of the 1/4CTLA-4 isoform is not known. By quantitative RT-PCR analysis, we examined the expression pattern of different isoforms of CTLA-4 in T cell subsets ex vivo and post in vitro activation. Remarkably, the expression of the splice variants of CTLA-4 are distributed in a similar pattern to flCTLA-4; that is, very low to undetectable expression in naïve T cells, intermediate expression in memory T cells and most abundantly expressed in T-reg cells (Fig. 1a). Upon activation of T cells with anti-CD3 and anti-CD28, the regulation kinetics of all four CTLA-4 variants appeared biphasic (Fig. 1b). In the case of fl- and liCTLA-4, T cell activation triggered an increase in transcription followed by a second wave of upregulation with a greater magnitude, with the peak of the second phase being at 48 h post-activation. In contrast, soluble CTLA-4 and 1/4CTLA-4 mRNA initially decreased after T cell activation and subsequently increased, also peaking after 48 h post-activation.

Figure 1. Expression of CTLA-4 isoforms in T cells.

Figure 1

Open in a new tab

Real-time PCR was performed on RNA extracted from a) T cell subsets purified from Foxp3.gfp KI mice, b) CD4+ T cells activated in vitro, and c) whole spleen from 21 d old mice. Transcript expression was normalized against β-actin (a) or β2 Microglobulin (b and c), values shown are the average of duplicate determinants and are either pooled or representative of assays using at least 3 using independent samples; ND, not detectable.

CTLA-4-/- mice develop severe lymphoproliferative disease and display early mortality (1, 2). In these mice, Ctla4 was disrupted by either complete or partial deletion of exons 2 and 3, raising the issue of whether CTLA-4-/- mice still maintained expression of the 1/4CTLA-4 isoform. Thus, we examined the expression of 1/4CTLA-4 in organs of 21 d old mice CTLA-4-/- mice. By real-time PCR analysis, soluble CTLA-4 could not be detected in any of the mice (data not shown). As expected, fl- and liCTLA-4 were expressed in wild type and CTLA-4+/- littermate samples but completely undetectable in CTLA-4 KO mice. However, 1/4CTLA-4 expression in the spleen was markedly increased in the KO mice compared with CTLA-4+/+ and CTLA-4+/- littermates (Fig. 1c). Thymus and heart samples gave the same expression pattern (data not shown). Thus, 1/4CTLA-4 expression was not eliminated, rather its transcript was elevated, in the original CTLA-4 KO mice. This raises the question of whether the lymphoproliferative disease and early lethality observed in the CTLA-4-/- is entirely due to loss of fl- and liCTLA-4 or whether overexpression of the 1/4CTLA-4 isoform contributes to this disease phenotype.

Overexpression of 1/4CTLA-4 leads to elevated cytokine production in T cells

To investigate the role of 1/4CTLA-4 in vivo, Tg mice overexpressing this genetic variant were generated on a wild type C57Bl/6 background (Fig. 2). As gene expression in these mice is under the control of the human CD2 promoter, 1/4CTLA-4 Tg mice overexpress 1/4Ctla4 in T cells. In these mice, T cells, either ex vivo or activated in vitro, overexpress 1/4CTLA-4, as confirmed by real-time PCR (Fig. 2b). Three different 1/4CTLA-4 Tg lines were generated and all of the lines displayed a similar phenotype, most of the data presented here are from the 2167 founder line.

Figure 2. Overexpression of 1/4CTLA-4 in T cells in mice.

Figure 2

Open in a new tab

a) Diagram of the 1/4CTLA-4 Tg construct. b) After in vitro activation with plate-bound anti-CD3 plus soluble anti-CD28, 1/4CTLA-4 mRNA expression in T cells was compared in 1/4CTLA-4 Tg and non-Tg littermates by real-time PCR, values represent the average of duplicates and are representative of duplicate experiments.

To investigate T cell function in 1/4CTLA-4 Tg mice, we stimulated cells from peripheral LNs and spleen in vitro. Thymidine incorporation assays showed that proliferation of cells from naïve 1/4CTLA-4 Tg mice was not consistently different from cells of wild type littermates upon activation with soluble anti-CD3; however, cytokine production by T cells was always elevated in 1/4 CTLA-4 Tg mice (Fig. 3a). By ELISA, we found that IL-2, IL-17, IFN-γ, TNF, IL-10 and IL-6 production were all higher in T cells from 1/4CTLA-4 Tg mice compared with T cells from non-Tg littermates. IL-4 and IL-5 production were below the limits of detection (data not shown). Thus overexpression of 1/4CTLA-4 lead to general elevation of cytokine production not biased toward any particular T helper subset.

Figure 3. Elevated cytokine production and proliferation by 1/4CTLA-4 Tg T cells.

Figure 3

Open in a new tab

a) Splenocytes and b) purified T cell subsets were stimulated in vitro with soluble anti-CD3 without (a) or with (b) syngeneic APCs for 72 h; supernatants were collected after 20 h (IL-2) or 48 h (all other cytokines) and assayed for cytokine production. Cells were pulsed with 3H thymidine during the last 18 h of culture. Data displayed are the mean of triplicate cultures from a single experiment representative of 3 – 6 experiments. c) CD4+ T cells were stimulated in vitro with MOG35-55 peptide for 5 d, then washed and adoptively transferred into Thy1.1 congenic hosts and parked for 10 wk. Thy1.2+ donor cells were detected in spleen and peripheral LN by flow cytometry.

Highly purified naïve (Foxp3/GFP-CD44lowCD62Lhigh) and memory (Foxp3/GFPCD44high) CD4+ T cells were further examined to investigate the effect of overexpression of 1/4CTLA-4 on proliferation of these subsets. Upon activation with anti-CD3 in vitro, in the presence of irradiated syngeneic antigen presenting cells, memory T cells from 1/4CTLA-4 Tg mice proliferated more than their wild type counterparts (Fig. 3b). Naïve T cells from Tg and non-Tg animals, on the other hand, proliferated similarly. In CD4+Foxp3/GFP- cells that were not further fractionated, proliferation was similar to naïve T cells, likely due to the fact that only a small fraction of the Foxp3-/GFP- cells were activated/memory cells.

To investigate the fate of 1/4CTLA-4 Tg activated/memory T cells in vivo, 1/4CTLA-4 Tg mice were crossed with MOG35-55 TCR 2D2 Tg Thy1.2 mice. T cells from 2D2 Tg Thy1.2 mice were activated in vitro with MOG35-55 peptide, allowed to rest (5 d in total), and then parked in Thy1.1 congenic mice. After 10 wk, most of the donor cells were recovered in the spleen with significantly more 1/4CTLA-4 Tg donor cells recovered compared with non-Tg donor cells (p =0.0069, Fig 3c), further demonstrating increased accumulation of activated/memory T cells overexpressing 1/4CTLA-4 in vivo.

Activated/memory T cells accumulate in 1/4CTLA-4 Tg mice

Since activated/memory, and not naïve, T cells from 1/4CTLA-4 Tg mice show increased proliferative responses, we set out to determine whether or not this hyperproliferation would affect the composition of T cells in 1/4CTLA-4 Tg mice. Examination of the lymphoid compartments showed no defect in thymic development. The proportions of T and B cells in the spleen and peripheral LNs were similar to those in non-Tg littermates (Fig. S1). Up to 10 wk of age, the cellularity and expression of activation markers (CD25, CD69) on T cells from the lymphoid organs were no different between non-Tg and 1/4CTLA-4 Tg littermates (Fig. 4a Fig. S1). However, 1/4CTLA-4 Tg mice had significantly elevated frequencies of CD4+ memory (CD44high) T cells in the spleen and showed a trend toward increased frequency of memory T cells in both the CD4 and CD8 compartments in the peripheral lymphoid compartments (Fig. 4b).

Figure 4. Increased accumulation of activated/memory T cells in 1/4CTLA-4 Tg mice.

Figure 4

Open in a new tab

a-c) Splenocytes and peripheral LNs were isolated and the cells stained for indicated cell surface markers and analyzed by flow cytometry. Mice aged 8-10 wk (a and b) and > 1year old (c). d) Spleen and peripheral LNs from mice > 1 year old.

Interestingly, the accumulation of activated/memory T cells observed in 1/4CTLA-4 Tg mice was more obvious as the mice aged. In mice older than 1 year, the frequencies of T cells expressing CD25 and CD69 were elevated in 1/4CTLA-4 Tg mice compared with wild type littermates (Fig. 4c and Fig. S1c). It should be noted that in some of the 1/4CTLA-4 Tg mice, almost all CD4+ (>80%) and CD8+ (>75%) T cells in the periphery expressed high CD44 at high levels (Fig 4c). Further, the accumulation of CD4+ memory T cells was so great that the frequency of naïve T cells remaining in the spleen and LNs in some mice was very low (Fig. 4c) and was evident in both the CD4+ and CD8+ compartments. However, the proportions of CD4+ and CD8+ T cells in the secondary lymphoid organs were not altered by overexpression of 1/4CTLA-4, even with increased age (Fig. S1b and c). With the increased frequency of activated/memory T cells in the peripheral repertoire, some, but not all mice over 1 year old, developed lymphadenopathy and splenomegaly (Fig. 4d). Upon histological analyses, the major organs in 1/4CTLA-4 Tg mice were grossly normal and in mice older than 1 year there were no signs of inflammatory infiltrates in contrast to the inflammation that develops in multiple organs in the CTLA-4 KO mice (data not shown).

Increased accumulation of activated/memory T cells can result from increased proliferation, or increased survival, or both. We showed that CD44high T cells were hyperproliferative (Fig. 3b and c), thus in vitro activation-induced cell death assays were performed to assess T cell survival. 1/4CTLA-4 Tg T cells in general did not survive better than T cells from non-Tg littermates upon restimulation (Fig. S2). Our data thus indicate that activated/memory T cells accumulate in 1/4CTLA-4 Tg mice as the mice age due to hyperproliferation of the activated/memory T cell subset.

Autoantibody responses in mice overexpressing 1/4CTLA-4

Since T cells from naïve 1/4CTLA-4 Tg mice accumulate activated/memory T cells, we investigated development of autoimmunity in these mice. First, we assessed the production of autoantibodies in 1/4CTLA-4 Tg mice using antigen arrays spotted with a panel of self-antigens. We found that when compared to wild type littermates, 1/4CTLA-4 Tg mice had elevated autoantibody levels in their sera which reacted towards a wide range of antigens associated with diverse autoimmune diseases, rather than specific to any one autoimmune disease (Fig. 5a). This suggests that the self-reactivity is not restricted to a particular tissue or organ. In line with the increased accumulation of activated/memory T cells in older 1/4CTLA-4 Tg mice, the production of autoantibodies strongly correlated with the age of the mice (Fig. 5b).

Figure 5. Elevated autoantibodies in 1/4CTLA-4 Tg mice.

Figure 5

Open in a new tab

Sera from 1/4CTLA-4 Tg and non-Tg mice at various ages were assessed for reactivity against an array of self-antigens mobilized onto glass slides; antigens that Tg and non-Tg sera reacted significantly differently against (p<0.01) are displayed. a) Heatmap shows reactivity represented in red and lack of reactivity in green. Each row represents an antigen and each column represents an individual serum sample. 1/4CTLA-4 Tg sera indicated in yellow and non-Tg sera in blue. The samples were hierarchically clustered together based on the expression pattern of autoantibodies. b) Normalized signal is displayed as a function of age of the mice.

Given that overexpression of 1/4CTLA-4 in these mice is restricted to T cells, the effect of overexpression of this gene on elevated autoantibody production is likely due to T-dependent B cell responses. T follicular helper cells have been described as having a critical role in the generation of germinal centers and antibody responses (23, 24), therefore, we examined the generation of this subset in 1/4CTLA-4 Tg mice. Mice were immunized with MOG35-55 peptide emulsified in CFA and the frequency of CD4+CXCR5+ICOS+ cells in the draining LNs and spleens were determined 6 d later. There was no apparent difference in the generation of T follicular helper cells in 1/4CTLA-4 Tg and non-Tg mice upon immunization (Fig. S3a). It is conceivable that immunization with a high dose antigen together with adjuvant can mask any subtle effects that overexpression of 1/4CTLA-4 could have on the generation of T follicular helper cells. Thus we examined generation of germinal centers in aged 1/4CTLA-4 mice without immunization. 1/4CTLA-4 Tg mice aged to 1 year developed germinal centers spontaneously containing a distinct population of germinal center B cells (CD19+PNA+Fas+GL7+IgD-) that was minor in the peripheral LN and scarce in the spleen of non-Tg littermates (Fig S3b). Thus, there is a difference in help provided to B cells in 1/4CTLA-4 Tg mice as the mice aged.

Autoimmunity and antigen-specific responses in mice overexpressing 1/4CTLA-4

To investigate the role of 1/4CTLA-4 in autoimmunity, antigen-specific T cell responses were assessed. Mice were immunized with an epitope of myelin antigen MOG35-55 peptide emulsified in CFA and the cells from draining LNs were restimulated in vitro 8 d later to examine antigen-specific recall responses. T cells from 1/4CTLA-4 Tg mice proliferated more and produced more IL-17 when restimulated in vitro with MOG35-55 peptide than T cells from wild type littermates (Fig. 6a).

Figure 6. Antigen-specific responses and autoimmunity in 1/4CTLA-4 Tg mice.

Figure 6

Open in a new tab

Mice were immunized with a) 100 μg MOG35-55 peptide emulsified in CFA or b) 50 μg MOG35-55 peptide emulsified in CFA and pertussis toxin. a) Cells from the draining LNs were harvested after 8 d and restimulated in vitro to assess cytokine production, after 48 h, and proliferation after 72 h; values represent mean of 3 mice per group ±SEM, proliferation and cytokine production was measured in triplicate per mouse. Data are representative of at least 2 experiments. Mice were monitored for clinical signs of disease in b) induced and c) spontaneous EAE models; 1/4CTLA-4 Tg n= 13, non-Tg n=14. Data displayed are the mean±SEM of individual animals (b).

Given the elevated antigen-specific responses of T cells from 1/4CTLA-4 Tg mice observed in vitro, we next examined the role of this variant form of CTLA-4 in T cells using different models of experimental autoimmune encephalomyelitis (EAE). After immunization with a suboptimal dose (50 μg) of MOG35-55 /CFA plus pertussis toxin, 1/4CTLA-4 Tg mice developed more severe EAE than wild type littermate controls (Fig. 6b). The incidence of clinical and histopathological disease was higher and the onset of disease was accelerated in 1/4CTLA-4 Tg mice. Of the wild type mice that did develop EAE, the mean maximal clinical score was lower than in 1/4CTLA-4 Tg mice (2.3±0.837 vs. 3±0, mean±SD). However, immunization with a higher dose of MOG35-55 peptide (100 μg) yielded similar incidence and severity in the littermate controls as the mice overexpressing 1/4CTLA-4 (Data not shown), suggesting that strong immunization regimes can override differences caused by the 1/4CTLA-4 transgene. Therefore, 1/4CTLA-4 Tg mice crossed with MOG35-55 specific 2D2 TCR Tg mice were used to investigate the development of EAE in the absence of immunization. None of the 2D2 TCR Tg mice in our study developed EAE but over 40% of 1/4CTLA-4 Tg mice on the 2D2 Tg background developed EAE spontaneously with clinical signs of disease beginning as early as 4 wk of age (Fig. 6c). Thus, 1/4CTLA-4 Tg mice have increased antigen-specific T cell responses and develop more severe EAE than wild type littermates but this difference can be overridden by strong immunization regimes. Results from the two different models of EAE and the antigen arrays together suggest that overexpression of 1/4CTLA-4 leads to autoimmunity.

T-reg cell development in 1/4CTLA-4 Tg mice

Given that 1/4CTLA-4 is expressed constitutively at very high levels in T-reg cells (Fig. 1), and mice overexpressing this isoform develop autoimmunity (Fig. 5 and 6), we set out to determine whether overexpression of 1/4CTLA-4 had an effect on T-reg cell development. In the younger cohort of Foxp3.gfp knock-in (KI) reporter mice (8 – 10 wk old), the frequency of CD4+Foxp3/GFP+ T-reg cells in the periphery was not different in 1/4CTLA-4 Tg mice and wild type littermates (Fig. 7a and Fig. S1b and c). In aged mice, T-reg cell frequencies were slightly elevated in 1/4CTLA-4 Tg mice compared with non-Tg littermates. That is, spleens of aged 1/4CTLA-4 Tg mice (>1 year old) had elevated T-reg cell frequencies in the CD4 compartment compared with littermate non-Tg mice (p=0.0094); in the peripheral LNs, there was only a trend toward increased T-reg cell frequencies (Fig. 7a and Fig. S1c). Accumulation of T-reg cells in aged mice may reflect either an indirect effect due to the increase in the pool of activated/memory T cells, or a direct effect of overexpressing 1/4CTLA-4 in T-reg cells. The suppressive activity of highly purified CD4+Foxp3/GFP+ T-reg cells from 1/4CTLA-4 Tg and non-Tg littermates were compared using in vitro suppression assays and no clear difference was observed (data not shown). Thus, we investigated the suppressive ability of T-reg cells in vivo using a model of colitis. When naïve T cells (CD4+CD45RBhigh) from wild type mice were co-transferred with T-reg cells at 1:0.5 ratio, RAG1-/- mice receiving wild type T-reg cells were protected from colitis, whereas mice receiving 1/4CTLA-4 Tg T-reg cells developed colitis similarly to mice receiving only naïve T cells (Fig. 7b). When more T-reg cells were co-transferred, at a 1:1 ratio, all mice were protected from colitis (data not shown). Neither 1/4CTLA-4 Tg nor non-Tg T-reg cells on their own caused weight loss in the RAG2-/- recipient mice (Fig. S4). These data suggest that T-reg cells from 1/4CTLA-4 Tg mice were less efficient at suppressing the effector functions of co-transferred naïve T cells. Of note, weight loss in recipient RAG1-/- mice was similar between mice reconstituted with donor 1/4CTLA-4 Tg- and non-Tg-derived naïve T cells (Fig. S4), further demonstrating that naïve T cells from 1/4CTLA-4 Tg mice were not hyperproliferative.

Figure 7. T-reg cell development and function in mice overexpressing 1/4CTLA-4.

Figure 7

Open in a new tab

T-reg cells were detected in spleen and peripheral LNs using GFP as the surrogate marker in Foxp3.gfp KI reporter mice. a) T-reg cell frequency was compared in 1/4CTLA-4 Tg and non-Tg littermates in 8-10 wk and ≥ 1 year old mice. b) RAG1-/- mice were reconstituted with wild type CD4+CD45RBhigh T cells together with T-reg cells (1:0.5 ratio) from either 1/4CTLA-4 or littermate wild type mice and their weights were monitored post-transfer. Values displayed are mean±SEM; data are pooled from 2 independent experiments, n=6 per group.

DISCUSSION

It is well established that full length CTLA-4 is a potent negative regulator of T cell activation. We previously demonstrated that liCTLA-4, an isoform associated with type 1 diabetes in mice, also inhibits T cell activation and replaces some of the functions of flCTLA-4 in mice (17, 19). Whereas liCTLA-4 is not expressed in humans, 1/4CTLA-4 is present in humans as well as mice, and also lacks the ligand-binding domain. To investigate the function of 1/4CTLA-4 in T cells, we generated Tg mice in which 1/4CTLA-4 is overexpressed constitutively and specifically in T cells. Upon stimulation, T cells from 1/4CTLA-4 Tg mice produce more cytokines than their wild type counterparts, most likely as a result of increased accumulation of activated/memory T cells in peripheral lymphoid tissues. As these mice age, this phenotype becomes more dramatic. Together with defective T-reg cell function, this culminates in autoimmunity in 1/4CTLA-4 Tg mice.

It has previously been shown that CTLA-4-deficient mice display early lethality caused by aggressive infiltration and damage of multiple organs by inflammatory cells and have hyperactive T cells (1, 2). However, our studies reveal that these mice lack all other isoforms of CTLA-4 (fl-, soluble and liCTLA-4), but overexpress 1/4CTLA-4 in peripheral T cells (Fig. 1c). When 1/4CTLA-4 was overexpressed in CTLA-4+/+ mice, a similar, but milder, form of the phenotype developed, raising the issue of how much overexpression of the 1/4CTLA-4 isoform contributed to the T cell hyperactivity observed in CTLA-4-deficient mice. These 1/4CTLA-4 Tg mice progressively accumulated activated/memory T cells and produced autoantibodies against many self-antigens (Fig. 5), but gross lymphadenopathy and splenomegaly was observed in only a small cohort of the Tg mice. However, spontaneous disease was not evident until mice were crossed with self-antigen TCR restricted Tg mice (Fig. 6c). Similar to CTLA-4 KO mice, 1/4CTLA-4 Tg mice had elevated antibody production to a diverse array of self-antigens (2). As transgenic expression of 1/4CTLA-4 in our mice is under the control of the human CD2 promoter, overexpression is restricted to T cells. Therefore, elevated autoantibody production in these mice (Fig. 5) likely reflects an increase in T-dependent B cell help (23, 24).

Our data suggest that the T cell subsets directly affected by overexpression of 1/4CTLA-4 are the subsets that usually express the CTLA-4 variants. While transgenic overexpression of 1/4CTLA-4 in our mice was on all T cells, it was the activated/memory, and not the naïve T cells that display altered T cell proliferation compared to their non-Tg counterparts (Fig. 3 and Fig. S4). Indeed, elevated cytokine production detected in the cultures containing bulk splenocytes and LN cells from 1/4CTLA-4 Tg mice is consistent with increased accumulation of activated/memory T cells (Fig. 3a). As with other splice variants, 1/4CTLA-4 is induced in activated T cells and constitutively and abundantly expressed in T-reg cells (Fig. 1). However, the proportion of CD4+ T cells that were Foxp3+ remained unaltered by transgenic overexpression of 1/4CTLA-4 until the mice were older (Fig. 7). Overexpression of 1/4CTLA-4 resulted in T-reg cells that were less efficient in protecting mice from colitis in a T cell transfer model. Indeed blockade of CTLA-4 in a similar model of colitis abrogated the suppressive activity of T-reg cells (13). By specifically deleting CTLA-4 on T-reg cells, it was recently shown that CTLA-4 expression is essential for T-reg cell function. Mice with CTLA-4-deficient T-reg cells exhibited a less aggressive form of the multi-organ lymphoproliferative disorder of CTLA-4 null mice, suggesting that CTLA-4 in both effector and T-reg cells both contribute to maintaining peripheral tolerance (7). Whether overexpression of 1/4CTLA-4 in the Tg mice enhances functions of effector T cells or interferes with the functions of T-reg cells or whether loss of T-reg cell functions result in the observed phenotype remains to be seen.

Further investigation will be required to elucidate the mechanisms of how the 1/4CTLA-4 splice variant enhances T cell activation. Both soluble CTLA-4 and liCTLA-4, have been previously reported to be functional variants despite the absence of transmembrane and ligand binding domains, respectively. It is conceivable that 1/4CTLA-4 could act as a dominant negative or alter the assembly of CD28 versus flCTLA-4 with the TCR in lipid rafts, thus stabilizing the immune synapse and promoting TCR signaling. 1/4CLT-4 is a small transcript composed of 166 bp (16), with the lack of specific reagents available, it is not known whether 1/4CTLA-4 mRNA is even translated as a protein. It is possible that 1/4CTLA-4 could act directly at the mRNA level to inhibit the expression of other isoforms of CTLA-4 like an shRNA or microRNA.

In this study, we show that 1/4CTLA-4 overexpressed in T cells affects the function of activated/memory T and T-reg cells. Our data indicate that, unlike liCTLA-4, 1/4CTLA-4 has distinct, and likely, opposing functions to flCTLA-4. Therefore isoform-specific manipulation of 1/4CTLA-4 expression represents a new avenue for therapeutic intervention for inflammatory diseases and tumor progression.

Supplementary Material

1

ACKNOWLEDGEMENTS

We thank D. Kozoriz for cell sorting and J. Sullivan for technical assistance.

Footnotes

1

This work was supported by the National Institutes of Health: AI044880 (VKK), NS038037 (VKK), AI075285 (FJQ), AI093903 (FJQ) and the JDRF center for Immunological Tolerance at Harvard: 7-2005-1329 and 4-2007-1057. SML is a NHMRC CJ Martin Research Fellow and APRS is a JDRF postdoctoral fellow. VKK is the recipient of a Javits Neuroscience Investigator Award from the National Institutes of Health (NS30843). FJQ was supported by the NMSS, RG4111A1. LSW is supported by grants from the JDRF and the Wellcome Trust and LSW is a Wellcome Trust Principal Research Fellow. The Cambridge Institute for Medical Research is the recipient of a Wellcome Trust Strategic Award (079895). AMP was funded by National Multiple Sclerosis Society grant FG 1805-A-1. This work was supported by Award P01AI039671 from the National Institute of Allergy and Infectious Diseases to VKK, LSW and AHS. The content of this article is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Allergy and Infectious Diseases or the National Institutes of Health.

4

Abbreviations used in this paper: LN, lymph node; Tg, transgenic; T-reg, regulatory T; fl, full-length; li, ligand-independent; EAE, experimental autoimmune encephalomyelitis; KI, knock-in; CT, cycle threshold.

REFERENCES

  • 1.Tivol EA, Borriello F, Schweitzer AN, Lynch WP, Bluestone JA, Sharpe AH. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity. 1995;3:541–547. doi: 10.1016/1074-7613(95)90125-6. [DOI] [PubMed] [Google Scholar]
  • 2.Waterhouse P, Penninger JM, Timms E, Wakeham A, Shahinian A, Lee KP, Thompson CB, Griesser H, Mak TW. Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Science (New York, N.Y. 1995;270:985–988. doi: 10.1126/science.270.5238.985. [DOI] [PubMed] [Google Scholar]
  • 3.Teft WA, Kirchhof MG, Madrenas J. A molecular perspective of CTLA-4 function. Annual review of immunology. 2006;24:65–97. doi: 10.1146/annurev.immunol.24.021605.090535. [DOI] [PubMed] [Google Scholar]
  • 4.Mandelbrot DA, McAdam AJ, Sharpe AH. B7-1 or B7-2 is required to produce the lymphoproliferative phenotype in mice lacking cytotoxic T lymphocyte-associated antigen 4 (CTLA-4). J Exp Med. 1999;189:435–440. doi: 10.1084/jem.189.2.435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Perkins D, Wang Z, Donovan C, He H, Mark D, Guan G, Wang Y, Walunas T, Bluestone J, Listman J, Finn PW. Regulation of CTLA-4 expression during T cell activation. J Immunol. 1996;156:4154–4159. [PubMed] [Google Scholar]
  • 6.Takahashi T, Tagami T, Yamazaki S, Uede T, Shimizu J, Sakaguchi N, Mak TW, Sakaguchi S. Immunologic self-tolerance maintained by CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. J Exp Med. 2000;192:303–310. doi: 10.1084/jem.192.2.303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wing K, Onishi Y, Prieto-Martin P, Yamaguchi T, Miyara M, Fehervari Z, Nomura T, Sakaguchi S. CTLA-4 control over Foxp3+ regulatory T cell function. Science (New York, N.Y. 2008;322:271–275. doi: 10.1126/science.1160062. [DOI] [PubMed] [Google Scholar]
  • 8.Brunkow ME, Jeffery EW, Hjerrild KA, Paeper B, Clark LB, Yasayko SA, Wilkinson JE, Galas D, Ziegler SF, Ramsdell F. Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet. 2001;27:68–73. doi: 10.1038/83784. [DOI] [PubMed] [Google Scholar]
  • 9.Gerold KD, Zheng P, Rainbow DB, Zernecke A, Wicker LS, Kissler S. The soluble ctla-4 splice variant protects from type 1 diabetes and potentiates regulatory T-cell function. Diabetes. 2011;60:1955–1963. doi: 10.2337/db11-0130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Leach DR, Krummel MF, Allison JP. Enhancement of antitumor immunity by CTLA-4 blockade. Science (New York, N.Y. 1996;271:1734–1736. doi: 10.1126/science.271.5256.1734. [DOI] [PubMed] [Google Scholar]
  • 11.Karandikar NJ, Vanderlugt CL, Walunas TL, Miller SD, Bluestone JA. CTLA-4: a negative regulator of autoimmune disease. J Exp Med. 1996;184:783–788. doi: 10.1084/jem.184.2.783. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Perez VL, Van Parijs L, Biuckians A, Zheng XX, Strom TB, Abbas AK. Induction of peripheral T cell tolerance in vivo requires CTLA-4 engagement. Immunity. 1997;6:411–417. doi: 10.1016/s1074-7613(00)80284-8. [DOI] [PubMed] [Google Scholar]
  • 13.Read S, Greenwald R, Izcue A, Robinson N, Mandelbrot D, Francisco L, Sharpe AH, Powrie F. Blockade of CTLA-4 on CD4+CD25+ regulatory T cells abrogates their function in vivo. J Immunol. 2006;177:4376–4383. doi: 10.4049/jimmunol.177.7.4376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Garber K. Melanoma antibody approved. Nat Biotech. 2011;29:375–375. [Google Scholar]
  • 15.Hill NJ, Lyons PA, Armitage N, Todd JA, Wicker LS, Peterson LB. NOD Idd5 locus controls insulitis and diabetes and overlaps the orthologous CTLA4/IDDM12 and NRAMP1 loci in humans. Diabetes. 2000;49:1744–1747. doi: 10.2337/diabetes.49.10.1744. [DOI] [PubMed] [Google Scholar]
  • 16.Ueda H, Howson JM, Esposito L, Heward J, Snook H, Chamberlain G, Rainbow DB, Hunter KM, Smith AN, Di Genova G, Herr MH, Dahlman I, Payne F, Smyth D, Lowe C, Twells RC, Howlett S, Healy B, Nutland S, Rance HE, Everett V, Smink LJ, Lam AC, Cordell HJ, Walker NM, Bordin C, Hulme J, Motzo C, Cucca F, Hess JF, Metzker ML, Rogers J, Gregory S, Allahabadia A, Nithiyananthan R, Tuomilehto-Wolf E, Tuomilehto J, Bingley P, Gillespie KM, Undlien DE, Ronningen KS, Guja C, Ionescu-Tirgoviste C, Savage DA, Maxwell AP, Carson DJ, Patterson CC, Franklyn JA, Clayton DG, Peterson LB, Wicker LS, Todd JA, Gough SC. Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature. 2003;423:506–511. doi: 10.1038/nature01621. [DOI] [PubMed] [Google Scholar]
  • 17.Vijayakrishnan L, Slavik JM, Illes Z, Greenwald RJ, Rainbow D, Greve B, Peterson LB, Hafler DA, Freeman GJ, Sharpe AH, Wicker LS, Kuchroo VK. An autoimmune disease-associated CTLA-4 splice variant lacking the B7 binding domain signals negatively in T cells. Immunity. 2004;20:563–575. doi: 10.1016/s1074-7613(04)00110-4. [DOI] [PubMed] [Google Scholar]
  • 18.Chikuma S, Abbas AK, Bluestone JA. B7-independent inhibition of T cells by CTLA-4. J Immunol. 2005;175:177–181. doi: 10.4049/jimmunol.175.1.177. [DOI] [PubMed] [Google Scholar]
  • 19.Araki M, Chung D, Liu S, Rainbow DB, Chamberlain G, Garner V, Hunter KM, Vijayakrishnan L, Peterson LB, Oukka M, Sharpe AH, Sobel R, Kuchroo VK, Wicker LS. Genetic evidence that the differential expression of the ligand-independent isoform of CTLA-4 is the molecular basis of the Idd5.1 type 1 diabetes region in nonobese diabetic mice. J Immunol. 2009;183:5146–5157. doi: 10.4049/jimmunol.0802610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Bettelli E, Pagany M, Weiner HL, Linington C, Sobel RA, Kuchroo VK. Myelin oligodendrocyte glycoprotein-specific T cell receptor transgenic mice develop spontaneous autoimmune optic neuritis. J Exp Med. 2003;197:1073–1081. doi: 10.1084/jem.20021603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bettelli E, Carrier Y, Gao W, Korn T, Strom TB, Oukka M, Weiner HL, Kuchroo VK. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 2006;441:235–238. doi: 10.1038/nature04753. [DOI] [PubMed] [Google Scholar]
  • 22.Quintana FJ, Hagedorn PH, Elizur G, Merbl Y, Domany E, Cohen IR. Functional immunomics: microarray analysis of IgG autoantibody repertoires predicts the future response of mice to induced diabetes. Proc Natl Acad Sci U S A 101 Suppl. 2004;2:14615–14621. doi: 10.1073/pnas.0404848101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Breitfeld D, Ohl L, Kremmer E, Ellwart J, Sallusto F, Lipp M, Forster R. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J Exp Med. 2000;192:1545–1552. doi: 10.1084/jem.192.11.1545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Schaerli P, Willimann K, Lang AB, Lipp M, Loetscher P, Moser B. CXC chemokine receptor 5 expression defines follicular homing T cells with B cell helper function. J Exp Med. 2000;192:1553–1562. doi: 10.1084/jem.192.11.1553. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS336771-supplement-1.pdf (1.1MB, pdf)

RESOURCES