Table 3. Primers for IRAP analysis.
| Name | Sequence | TE, region |
|---|---|---|
| 2106 | taatttctgcaacgttccccaaca | WIS2, LTR |
| 2108 | agagccttctgctcctcgttgggt | Wilma, LTR |
| 2109 | tacccctactttagtacaccgaca | Daniela, LTR |
| 2115 | caagcttgccttccacgccaag | Fatima, LTR |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.