Table 1. Sequences of novel miRNAs identified by the degradome sequencing in maize.
miRNA | Sequence | Lengthnt | Chr | Start | End |
miRC47 miR169w | UAGCCAAGGAUGAGCUGCCUG | 21 | 2 | 189774689 | 189774920 |
miRC48 | UUCUUAGGAAAAGAGGUCGGC | 21 | 8 | 15615633 | 15615772 |
miRC49 | AAUCCGUGAUGCAAGACAAUU | 21 | 3 | 122633333 | 122633582 |
miRC50 | UGCUGUGAUGAAGAUGCUCA | 20 | 9 | 143934647 | 143934803 |
miRC51 | UCCAAGGAAGACACUCGGCAAA | 22 | 3 | 117417189 | 117417259 |
22 | 7 | 72813292 | 72813363 |
New paralogs of pre-existing miRNA families were cross-referenced and highlighted.