Skip to main content
. 2012 Jan 3;7(1):e29669. doi: 10.1371/journal.pone.0029669

Table 1. Sequences of novel miRNAs identified by the degradome sequencing in maize.

miRNA Sequence Lengthnt Chr Start End
miRC47 miR169w UAGCCAAGGAUGAGCUGCCUG 21 2 189774689 189774920
miRC48 UUCUUAGGAAAAGAGGUCGGC 21 8 15615633 15615772
miRC49 AAUCCGUGAUGCAAGACAAUU 21 3 122633333 122633582
miRC50 UGCUGUGAUGAAGAUGCUCA 20 9 143934647 143934803
miRC51 UCCAAGGAAGACACUCGGCAAA 22 3 117417189 117417259
22 7 72813292 72813363

New paralogs of pre-existing miRNA families were cross-referenced and highlighted.