Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Mouse tissue-specific deletion of Casr. To verify tissue-specific gene excision, genomic DNA isolated from Casr KO and control littermates of specified tissues was subjected to PCR analysis with the P4 (CCTCGAACATGAACAACTTAATTCGG)/P3L (CGAGTACAGGCTTTGATGC) primer set, which amplified a 284-bp DNA fragment from the Casr gene allele after the excision of exon 7.
