Skip to main content
BMC Gastroenterology logoLink to BMC Gastroenterology
. 2011 Dec 22;11:141. doi: 10.1186/1471-230X-11-141

Association between Helicobacter pylori cagA-related genes and clinical outcomes in Colombia and Japan

Masahide Watada 1,2, Seiji Shiota 1,2, Osamu Matsunari 1,2, Rumiko Suzuki 1, Kazunari Murakami 2, Toshio Fujioka 2, Yoshio Yamaoka 1,3,
PMCID: PMC3260095  PMID: 22189161

Abstract

Background

Specific genotypes of several virulence factors of Helicobacter pylori (eg, cagA-positive, vacA s1, oipA "on" and babA-positive) have been reported to be predictors of severe clinical outcomes. Importantly, the presence of these genotypes correlates with each other. We hypothesized that novel virulence genes correlate with the presence of cagA. Therefore, we aimed to find novel candidate virulence genes that correlate with cagA and examined the association of these genes with clinical outcomes in Colombian and Japanese populations.

Methods

cagA-associated genes were selected based on previous H. pylori genome microarray data. A total of 343 strains (174 from Colombia and 169 from Japan) were examined for the status of cagA, vacA, and candidate genes by polymerase chain reaction and dot blot.

Results

Microarray data showed that 9 genes were significantly correlated with the presence of cagA. Among the 9 genes, the functions of 4 were known, and we selected these 4 genes as candidate genes (hp0967, jhp0045, jhp0046, and jhp0951). The prevalences of cagA, vacA s1/m1 genotype, and hp0967 were significantly higher in Japan than Colombia, whereas those of jhp0045 and jhp0046 were more prevalent in Colombia than Japan. The prevalences of jhp0045 and jhp0046 in cagA-positive cases of gastric cancer were significantly higher than those from gastritis in Colombia (P = 0.015 and 0.047, respectively). In contrast, the prevalence of 4 candidate genes was independent of clinical outcomes in Japan.

Conclusions

jhp0045 and jhp0046 might be novel markers for predicting gastric cancer in cagA-positive cases in Colombia, but not in Japan.

Background

Helicobacter pylori (H. pylori) infection is now accepted as the major cause of chronic gastritis. In addition, several epidemiological studies have shown that H. pylori infection is linked to severe gastritis-associated diseases, including peptic ulcer and gastric cancer (GC) [1]. In 1994, the International Agency for Research on Cancer categorized H. pylori infection as a group I carcinogen [2]. Although GC is one of the most common cancers, only a minority of individuals with H. pylori infection ever develop it. The prevalence of GC is approximately 3% in H. pylori-positive patients [3].

In addition to environmental factors (eg, diet) and host factors, virulence factors of H. pylori, such as cagA, vacA, oipA, babA, hopQ, and homA/B, have been demonstrated to be predictors of gastric atrophy, intestinal metaplasia, and severe clinical outcomes [4-10]. The most studied virulence factor of H. pylori is cagA, which is located at the end of an approximately 40-kb cluster of genes called cag pathogenicity island (PAI). cag PAI encodes a type-IV secretion system and transfers CagA protein into host cells [11]. CagA protein is believed to have oncogenic potential [12,13], and cagA-positive strains are reported to be associated with severe clinical outcomes [14].

However, these factors are not enough to distinguish markers for severe outcomes (eg, GC) in Japan because most H. pylori strains isolated in Japan possess these virulence factors. Likewise, our previous report showed that these genes were not virulence markers for GC in Colombia [10]. Importantly, the presence of these genotypes correlate with each other; the cagA-positive strain usually possesses the vacA s1/m1 genotype, and it is further closely linked to the presence of babA and oipA "on" status [14]. Therefore, we hypothesized that novel virulence genes correlate with the presence of cagA. Although cagA is not a distinguishing marker for severe outcomes in Japan and Colombia, the importance of cagA has been shown in both in vitro and in vivo experiments [14]. For example, our study showed that histological scores were significantly higher in cagA-positive subjects than cagA-negative ones, even in Japan [15]. Therefore, subjects infected with cagA-positive H. pylori can be considered as a higher risk population than those with cagA-negative strains, even in Japan and Colombia. However, only a minority of individuals with cagA-positive H. pylori infection develop severe outcomes in both countries. This suggests that other virulence factors in cagA-positive strains are necessary to develop severe outcomes.

Previous whole H. pylori genome microarray data revealed that several genes were associated with the presence of cagA and/or clinical outcomes. For example, Romo-González et al. examined 42 H. pylori strains and found that several genes were associated with gastroduodenal diseases [16]. In addition, Salama et al. used the microarray of 15 H. pylori strains and identified several genes that correlated with the presence of cag PAI [17], although they did not examine the association between these genes and clinical outcomes. However, these microarray data are not sufficient as conclusive evidence of the association due to the small sample size. Previously, we also performed whole H. pylori genome microarray and examined 1,531 genes, including cagA, in 56 H. pylori strains isolated from several countries [18].

In this study, we aimed to find novel candidate virulence genes that correlate with the presence of cagA, and we examined the association of these genes with clinical outcomes in Colombian and Japanese populations.

Methods

Microarray experiments

Initially, candidate genes were selected from previous studies by Salama et al. [17] and Romo-González et al. [16]. Microarray data from 56 strains in our previous report was then used for the examination of the association of candidate virulence genes with the presence of cagA [18].

Patients

H. pylori strains were obtained from the gastric mucosa of H. pylori-infected patients who underwent endoscopy at Oita University Faculty of Medicine, Oita, Japan, and Universidad Nacional de Colombia, Bogota, Colombia. Presentations included gastritis, duodenal ulcer (DU), gastric ulcer (GU), and GC. DU, GU, and GC were identified by endoscopy, and GC was further confirmed by histopathology. Gastritis was defined as H. pylori gastritis in the absence of peptic ulcers or gastric malignancy. Patients with a history of partial gastric resection were excluded. Patients who received H. pylori eradication therapy or treatment with antibiotics, bismuth-containing compounds, H2-receptor blockers, or proton pump inhibitors within 4 weeks prior to the study were also excluded. Informed consent was obtained from all participants, and the protocol was approved by the ethics committees of Oita University and Universidad Nacional de Colombia.

H. pylori genotyping

Antral biopsy specimens were obtained for the isolation of H. pylori using standard culture methods, as previously described [19]. Chromosomal DNA was extracted from confluent plate cultures expanded from a single colony using a commercially available kit (QIAGEN Inc., Valencia, CA, USA). Two H. pylori strains with full-sequenced genomes, 26695 (ATCC 700392) and J99 (ATCC 700824) deposited in the GenBank, were used as control strains. The cagA status was determined by polymerase chain reaction (PCR) using primer pair 5'-ACC CTA GTC GGT AAT GGG-3' and 5'-GCT TTA GCT TCT GAY ACY GC-3' (Y = C+T), as described previously [20]. The vacA genotyping (s1, s2, m1, and m2) was performed by PCR, as described previously [21,22]. Primers for the signal region yielded a fragment of 259 bp for s1 variants and one of 286 bp for s2 variants. Primers for the middle region yielded a fragment of 570 bp for m1 variants and one of 645 bp for m2 variants.

Two primer sets for each candidate gene were designed with software Primer 3 (version. 0.4.0) based on the published sequences of H. pylori (Table 1). Amplification of H. pylori genomic DNA sequences was carried out in a total volume of 25 μL containing 2.5 μL of PCR buffer, 0.2 mM of each deoxynucleotide, 0.625 U of Blend Taq DNA polymerase (Blend Taq, Toyobo Co., Ltd., Osaka, Japan), 0.2 μM of each primer, and more than 10 ng of H. pylori DNA. Each reaction mixture was amplified as follows: initial denaturation at 94°C for 5 min, which was followed by 30 cycles of denaturation at 94°C for 30 s, annealing at the indicated temperature in Table 1 for 30 s, extension at 72°C for 1 min, and then final extension at 72°C for 5 min. The amplified fragment was detected by 2.0% agarose gel electrophoresis using an ultraviolet transilluminator.

Table 1.

Primer sequences

Primer Name Primer Sequence (5'-3') Forward Primer Sequence (5'-3') Reverse AT (°C) Product size
hp0967-1 CATGGCTTTAAATGGCAACA CCGGCATTAAATCGTTGTTT 58 169
hp0967-2 TAGCGTGTATTTTGGCGATG GATAGCCGGCATTAAATCGT 59 151
jhp0045-1 TGGCAAAAGAGTCCAAGACA CGTTGCAATAAAAACGCAGA 59 180
jhp0045-2 AAAACAACGCCTGGTATTGC GATTGCACTTTATGCGTGTGA 60 158
jhp0046-1 AAGCAAGCGATAATGTCATGG AATTGAGCGTTTTGGTGTCC 59 154
jhp0046-2 AGCAAGCGATAATGTCATGG AATTGAGCGTTTTGGTGTCC 58 153
jhp0951-1 CAAAGCGTGAATGATTTGGA AGATTGCGCAAGGATTTGAG 56 194
jhp0951-2 ATGCGTGGCTAAGCGATACT GACCCAACGCTCTTGAAGTT 57 243

AT; annealing temperature

Dot blot

For each sample, 500 ng of total DNA was added to 100 μL of TE buffer and mixed with 100 μL of a denaturing buffer (0.5 M NaOH; 1.5 M NaCl). The denatured DNA was transferred to a Hybond-N+ membrane (GE HealthCare, Piscataway, NJ, USA) by means of a Bio-Dot Microfiltration Apparatus (Bio-Rad Laboratories, Inc., Hercules, CA, USA). DNA of J99 and human DNA were also transferred to the membrane and used as positive and negative controls, respectively. The membranes were hybridized at 42°C overnight in plastic bags containing ECL Gold hybridization buffer supplemented with 5% (wt/vol) blocking agent and 0.5 M NaCl. The membranes were washed 3 times in primary washing buffer (0.5× SSC [1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate] [pH 7.0], 0.4% sodium dodecyl sulfate) at room temperature for 15 min and 3 times in secondary washing buffer (2× SSC) at room temperature for 15 min. Finally, the membranes were exposed to Hyperfilm ECL film (GE HealthCare). Gene status was considered positive when at least one of the PCR reactions was positive. When gene status was considered negative by PCR, we further confirmed the results using dot-blot analyses. If PCR results yielded negative results but the dot blot showed a positive blot, we considered the samples positive.

DNA sequencing

DNA sequencing for the full length of jhp0045 (1,032 bp) was performed with several primer pairs located at jhp0044 and jhp0046. Likewise, DNA sequencing for the full length of jhp0046 (783 bp) was performed with several primer pairs located at jhp0045 and jhp0047. PCR products were purified with Centri-sep Columns (Applied Biosystems by Life Technologies, Tokyo, Japan), and the amplified fragments were sequenced with Hi-Di Formamide (Applied Biosystems by Life Technologies) using an ABI Prism 310 Genetic Analyzer (Applied Biosystems by Life Technologies, Carlsbad, CA, USA) in accordance with the manufacturer's instructions.

Statistical analysis

Variables such as gender, mean age, and the presence of each candidate gene and cagA were evaluated. The univariate association between each genotype and the clinical outcomes were quantified by the chi-square test. A multivariate logistic regression model was used to calculate the odds ratios (OR) of the clinical outcomes by including age, sex, and H. pylori genotypes. All determinants with P values of < 0.10 were entered together in the full model of logistic regression, and the model was reduced by excluding variables with P values of > 0.10. ORs and 95% confidence intervals (CIs) were used to estimate the risk. Spearman rank coefficients (r) were also determined to evaluate the association between the different genotypes of the strains. A P value of less than 0.05 was accepted as statistically significant. The SPSS statistical software package version 18.0 (IBM Corporation, Armonk, NY, USA) was used for all statistical analyses.

Results

Selection of candidate genes

Twelve genes that were strongly associated with cagA status in the report by Salama et al. [17] were selected. In addition, 26 genes that were associated with severe gastric diseases in the report by Romo-González et al. [16] were selected. Because hp1426 was reported in both reports, a total of 37 genes were selected as candidate genes, as shown in additional file 1.

Among the 37 genes, the status of 9 genes (hp0186, hp0713, hp0967, hp1409, hp1410, jhp0045, jhp0046, jhp0950, and jhp0951) were significantly correlated with the cagA status in our microarray data [18] (P = 0.026, 0.026, 0.014, 0.048, 0.030, 0.033, 0.033, 0.017, and 0.005 for each above gene, respectively). Among the 9 genes, 4 genes (hp0967, jhp0045, jhp0046, and jhp0951) were selected in our analyses because the functions of these genes are known. The presence of 3 genes (hp0967, jhp0045, and jhp0046) was inversely correlated with the presence of cagA, but that of jhp0951 was positively correlated with the presence of cagA. We examined the presence of these candidate genes in 28 full sequenced strains deposited in Genbank. The hp0967, jhp0045, jhp0046, and jhp0951 were found in 18, 7, 7, and 13 strains, respectively.

Prevalence of candidate genes in Japan and Colombia

The distribution of the status of cagA, vacA, hp0967, jhp0045, jhp0046, and jhp0951 in the two countries is shown in Table 2. Three samples from Colombia showed the positive for both vacA m1 and m2 genotypes, which suggest the mixed infection, were excluded in the final analysis. Finally, a total of 343 patients were included in this study: 174 from Colombia (68 with gastritis, 43 with DU, and 63 with GC) and 169 from Japan (49 with gastritis, 50 with DU, 50 with GU, and 20 with GC). The results from PCR and dot blot matched well: there were no cases with negative results by PCR and only positive results by dot blot. There were significant differences in the status of cagA, hp0967, jhp0045, and jhp0046 between strains isolated from Japanese and Colombian populations. The prevalence of cagA was 100% in Japan, whereas it was 65.5% in Colombia (P < 0.0001). Higher prevalences of vacA s1 and m1 genotypes were found in Japan than Colombia (100 vs. 76.8%, P < 0.001; 100 vs. 62.7%, < 0.001, respectively). The prevalence of hp0967 was significantly higher in Japan than Colombia (62.1 vs. 48.0%, P = 0.013). However, the prevalences of jhp0045 and jhp0046 were more prevalent in Colombia than Japan (23.7 vs. 8.9%, P < 0.0001; 28.2 vs. 8.9%, P < 0.0001, respectively). There was no difference in the prevalence of jhp0951 between the 2 countries.

Table 2.

Relationship between each gene and clinical outcomes in Colombia

Total gastritis DU GC
n 174 68 43 P 63 P
mean age 53.4 ± 16.4 52.0 ± 16.5 48.4 ± 15.9 0.50 58.1 ± 15.5 0.01
male 90 (50.8%) 28 (40.6%) 22 (50.0%) 0.30 40 (62.5%) 0.01
cagA 116 (65.5%) 44 (63.8%) 27 (61.4%) 0.83 45 (70.3%) 0.41
vacA s1 136 (76.8%) 50 (72.5%) 33 (75.0%) 0.70 54 (84.4%) 0.08
vacA m1 111 (62.7%) 38 (55.1%) 26 (59.1%) 0.63 48 (75.0%) 0.01
hp0967 85 (48.0%) 33 (47.8%) 20 (45.5%) 0.83 32 (50.0%) 0.79
jhp0045 42 (23.7%) 14 (20.3%) 13 (29.5%) 0.24 15 (23.4%) 0.65
jhp0046 50 (28.2%) 18 (26.1%) 15 (34.1%) 0.34 17 (26.6%) 0.94
jhp0951 102 (57.6%) 40 (58.0%) 26 (59.1%) 0.86 36 (56.3%) 0.84

DU, duodenal ulcer; GC, gastric cancer

*P value was compared with gastritis

The association between candidate genes and clinical outcomes in Colombia

The prevalence of each gene was examined according to clinical outcomes. The prevalence of the vacA m1 genotype was significantly higher in strains from patients with GC than those with gastritis (75.0 vs. 55.1%, P = 0.014) (Table 2). Although it is accepted that cagA is an important virulence factor, the prevalence of cagA was not different between the strains from patients with DU, GC, and gastritis in Colombia (61.4, 70.3, and 63.8%, P > 0.05), which was in agreement with our previous study [23]. Therefore, we hypothesized that the presence/absence of novel factors that accompany the presence of cagA leads to severe clinical outcomes in the Colombian population. Based on this hypothesis, the prevalences of these 4 candidate genes were examined in the cagA-positive cases. In cagA-positive cases, vacA status was not associated with clinical outcomes. Interestingly, the prevalence of jhp0045 in cagA-positive cases from GC was significantly higher than that of gastritis (30.4 vs. 11.4%, P = 0.023) (Table 3). The prevalence of jhp0046 in cagA-positive cases from GC also tended to be higher than that of gastritis (34.8 vs. 18.2%, P = 0.06), although this did not reach statistical significance. However, there were no associations of these candidates between gastritis and DU. Table 4 shows the association determined by a multivariate analysis between clinical outcomes and the presence of jhp0045 or jhp0046 in cagA-positive cases in the Colombian population. After adjustment for age and gender, jhp0045 was an independent factor for discriminating GC from gastritis in cagA-positive cases (adjusted OR = 3.24; 95% CI = 1.00-10.42; Table 4). Likewise, jhp0046 was an independent factor for discriminating GC from gastritis in cagA-positive cases (adjusted OR = 3.16; 95% CI = 1.05-9.47). On the other hand, the prevalences of hp0967 and jhp0951 in cagA-positive cases were not associated with clinical outcomes.

Table 3.

Relationship between each gene and clinical outcomes in cagA-positive cases in Colombia

Gastritis DU GC
n 44 27 P 45 P
mean age 51.0 ± 15.3 47.2 ± 14.3 0.51 57.6 ± 14.3 0.02
male 19 (43.2%) 13 (46.4%) 0.68 31 (67.4%) 0.02
vacA s1 42 (95.5%) 24 (85.7%) 0.27 42 (91.3%) 0.51
vacA m1 33 (75.0%) 19 (67.9%) 0.66 36 (78.3%) 0.37
hp0967 24 (54.5%) 12 (42.9%) 0.40 27 (58.7%) 0.60
jhp0045 5 (11.4%) 7 (25.0%) 0.10 14 (30.4%) 0.02
jhp0046 8 (18.2%) 7 (25.0%) 0.43 16 (34.8%) 0.06
jhp0951 25 (56.8%) 19 (67.9%) 0.25 27 (58.7%) 0.76

DU, duodenal ulcer; GC, gastric cancer

*P value was compared with gastritis

Table 4.

Multivariate analyses of the risk for GC by age, gender, and jhp0045 or jhp0046 status in cagA-positive cases in Colombia

Adjusted OR 95% CI P
Age (per 1 year) 1.02 0.99-1.05 0.10
Gender (male) 3.19 1.29-7.89 0.01
jhp0045 3.24 1.00-10.42 0.04

Age (per 1 year) 1.02 0.99-1.05 0.11
Gender (male) 3.15 1.27-7.80 0.01
jhp0046 3.16 1.05-9.47 0.03

CI, confidence interval; GC, gastric cancer; OR, odds ratio

The association between candidate genes and clinical outcomes in Japan

All samples from Japan showed cagA-positive and vacA s1m1. The prevalences of the 4 candidate genes in cagA-positive cases were independent of clinical outcomes (Table 5).

Table 5.

Prevalence of each gene and relationship between each gene and clinical outcomes in Japan

Total gastritis DU GU GC
n 169 49 50 P 50 P 20 P
mean age 60.0 ± 12.8 59.3 ± 12.8 56.0 ± 13.6 0.19 62.9 ± 12.1 0.25 64.3 ± 9.4 0.13
male 91 (53.8%) 24 (49.0%) 29 (58.0%) 0.36 27 (54.0%) 0.61 11 (55.0%) 0.65
cagA 169 (100.0%) 49 (100.0%) 50 (100.0%) - 50 (100.0%) - 20 (100.0%) -
vacA s1 169 (100.0%) 49 (100.0%) 50 (100.0%) - 50 (100.0%) - 20 (100.0%) -
vacA m1 169 (100.0%) 49 (100.0%) 50 (100.0%) - 50 (100.0%) - 20 (100.0%) -
hp0967 105 (62.1%) 30 (61.2%) 31 (62.0%) 0.93 34 (68.0%) 0.48 10 (50.0%) 0.39
jhp0045 15 (8.9%) 2 (4.1%) 6 (12.0%) 0.14 5 (10.0%) 0.22 2 (10.0%) 0.32
jhp0046 15 (8.9%) 2 (4.1%) 6 (12.0%) 0.14 5 (10.0%) 0.22 2 (10.0%) 0.32
jhp0951 108 (63.9%) 31 (63.3%) 30 (60.0%) 0.73 35 (70.0%) 0.47 12 (60.0%) 0.80

DU, duodenal ulcer; GU, gastric ulcer; GC, gastric cancer

Sequence analysis of jhp0045 and jhp0046 in Colombia and Japan

In order to clarify whether the sequence variants in jhp0045 and jhp0046 contributed to the different outcomes in Colombia and Japan, sequences of these 2 genes were compared using 8 randomly selected strains. For jhp0045, one-point mutation in the Japanese strains was found at 643-bp position of J99 (A643G). Therefore, the amino acid was changed from Ile to Val. The sequence of jhp0045 from the Colombian strains matched with J99. On the other hand, there was no difference in the sequence of jhp0046 between the strains from the 2 countries.

Nucleotide sequence accession numbers

The nucleotide sequences of jhp0045 and jhp0046 for 8 strains (Japanese strains: 01-401, 04-156, 05-262, and 07-238; Colombian strains: Colombia 64, Colombia 114, Colombia 174, and Colombia 229) have been deposited in the GenBank database under accession no. AB647162 to AB647169 for jhp0045 and AB647170 to AB647176 for jhp0046, respectively.

Discussion

Our study revealed that jhp0045 and jhp0046 were independent discriminating factors for GC from gastritis in cagA-positive cases in Colombia. This suggests that jhp0045 and jhp0046 play a role in high-risk subjects, such as cagA-positive H. pylori-infected cases.

Several genes of H. pylori were reported as virulence factors, and these include cagA, vacA, oipA, babA, hopQ, and homA/B [4-10]. Importantly, most virulence factors correlated with each other; cagA-positive strains also possess the vacA s1/m1 genotype, and this is closely linked to the presence of the babA and oipA "on" status [14]. Therefore, we hypothesized that undefined novel virulence genes could exist in genes correlated with cagA status. Although previous microarray data showed that several genes correlated with cagA status, the sample number in these microarray reports was not enough to be conclusive (eg, [15] strains in the report by Salama et al. [17]). Among the 37 genes we selected, 9 genes were significantly correlated with the presence of cagA. In the present study, we focused on 4 genes whose functions have been revealed. hp0967 is considered a virulence-associated protein D, and jhp0951, which encodes an integrase of the XerCD family, has been reported to be related to modifications in the response to low pH and iron limitations [16,24]. The putative functions of jhp0045 and jhp0046 have been described as type-II DNA methyltransferase and type-II restriction enzymes, respectively [17,25].

Among these 4 genes, jhp0045 and jhp0046 were significantly associated with severe clinical outcomes in cagA-positive cases in Colombia. Although hp0967 has been reported to be negatively associated with DU [16], there was no association in this study. The jhp0951 has been positively associated with DU [16]; however, an association was not found in this study. These findings suggest that these microarray data are not conclusive. A larger group of subjects is necessary to clarify the association.

The mechanisms of the development of GC in those patients infected with jhp0045 or jhp0046 are unclear, although the putative functions of jhp0045 and jhp0046 have been described as a type-II DNA methyltransferase and a type-II restriction enzyme, respectively [17,25]. In this study, most strains possessing jhp0045 had jhp0046. This suggests that these 2 genes may work together. This combination of a restriction enzyme and a methyltransferase is known as a restriction-modification (R-M) system [26]. It has been reported that H. pylori possess an extraordinary number of genes with homology to R-M genes in other bacterial species [25,27,28]. However, not all R-M systems have that function. Kong et al. reported that, among the 16 completely tested Type II R-M systems in J99, only 4 were fully functional in that they contained both active endonucleases and methylases [29]. The jhp0045 and jhp0046 were included in these functional ones. Because several R-M systems are correlated with pathogenicity [26], strains possessing jhp0045 and jhp0046 may be considered as truly virulent strains. Interestingly, recent reports showed that H. pylori strains possessing cagA from Colombia can be divide into 2 groups by 7 housekeeping genes [30]. This grouping was related with severe histological scores and the prevalence of GC. The jhp0045 and jhp0046 may be a discriminating factor for this grouping. Further study is necessary in order to examine the relationship between jhp0045 and jhp0046 and the grouping by 7 housekeeping genes.

Only 1 change of an amino acid resulted from a point mutation of jhp0045 in Japanese strains compared with Colombian strains and J99. It is not clear whether this difference contributed to the different results between the 2 countries. Variants of virulence factors in different areas may result in different clinical outcomes. For example, cagA can be divided into 2 types (East-Asian-type cagA and Western-type cagA) according to differences in the 3' region [6,20,21]. Some reports have shown that individuals infected with East-Asian-type cagA strains have an increased risk of peptic ulcer or GC compared to those infected with Western-type cagA strains [31,32]. Further studies to clarify the mechanisms or functions according to the different amino acid sequences are necessary to explain this.

Our study had several limitations. First, not only the H. pylori virulence factors, but also environmental factors (eg, diet) and host factors have been demonstrated to be predictors of severe clinical outcomes [33]. Especially, inflammatory cytokine gene polymorphisms (IL-1 gene cluster, TNF-α, IL-10, and IL-8) have been reported to be correlated with gastric cancer [34-39]. Further study will be necessary in order to elucidate the role of our candidate genes of H. pylori. Second, we did not examine known virulence factors other than cagA and vacA of H. pylori. It is possible that our candidate genes might correlate with other known virulence factors, even in cagA-positive cases. It is better to examine host factors and other known virulence factors in order to clarify the role of our candidate genes in future studies. Finally, we examined the status of the genes by only positivity or negativity. The levels of gene expression can be affected by clinical outcomes. In addition, gene expression is not always correlated with protein expression patterns. For example, the expression of the blood group antigen-binding adhesin (BabA) protein is not always correlated with babA gene expression [40]. Further analysis using real-time PCR or immunoblotting techniques is necessary to clarify the significance of our candidate genes.

Conclusions

The jhp0045 and jhp0046 were associated with GC in cagA-positive cases in Colombia but not in Japan. In Colombia, the status of jhp0045 and jhp0046 may predict the future development of GC for patients with gastritis. A prospective study is necessary to confirm this. Moreover, the study of the distribution of these genes in other populations would be interesting in order to further elucidate the associations found in the present study and the possible virulence role of these factors in H. pylori infection.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

Conceived and designed the experiments: MW SS YY. Performed experiments: MW OM. Analyzed the data: MW SS RS YY. Contributed reagents/materials/analysis tools: MW OM SS YY KM TF. Wrote the paper: MW SS YY. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-230X/11/141/prepub

Supplementary Material

Additional file 1

Selected 37 genes. A total of 37 genes were selected as candidate genes from two reports (Salama et al. [17] and Romo-González et al. [16]).

Click here for file (11.5KB, XLSX)

Contributor Information

Masahide Watada, Email: m08d9036@oita-u.ac.jp.

Seiji Shiota, Email: sshiota@oita-u.ac.jp.

Osamu Matsunari, Email: narry@oita-u.ac.jp.

Rumiko Suzuki, Email: rusuzuki@oita-u.ac.jp.

Kazunari Murakami, Email: murakam@oita-u.ac.jp.

Toshio Fujioka, Email: fujioka@oita-u.ac.jp.

Yoshio Yamaoka, Email: yyamaoka@oita-u.ac.jp.

Acknowledgements

This report is based on work supported in part by grants from the National Institutes of Health (DK62813), grants-in-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) of Japan (22390085, 22659087 and 30583778), and Special Coordination Funds for Promoting Science and Technology from MEXT of Japan. The authors would like to thank Ms. Kudo, Ms. Matsuda, and Ms. Takahashi for their excellent technical assistance.

Financial support: None

References

  1. Suerbaum S, Michetti P. Helicobacter pylori infection. N Engl J Med. 2002;347(15):1175–1186. doi: 10.1056/NEJMra020542. [DOI] [PubMed] [Google Scholar]
  2. Schistosomes, liver flukes and Helicobacter pylori. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lyon, 7-14 June 1994. IARC Monogr Eval Carcinog Risks Hum. 1994;61:1–241. [PMC free article] [PubMed] [Google Scholar]
  3. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M, Taniyama K, Sasaki N, Schlemper R. Helicobacter pylori infection and the development of gastric cancer. N Engl J Med. 2001;345(11):784–789. doi: 10.1056/NEJMoa001999. [DOI] [PubMed] [Google Scholar]
  4. Jung SW, Sugimoto M, Graham DY, Yamaoka Y. homB status of Helicobacter pylori as a novel marker to distinguish gastric cancer from duodenal ulcer. J Clin Microbiol. 2009;47(10):3241–3245. doi: 10.1128/JCM.00293-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Lu H, Hsu PI, Graham DY, Yamaoka Y. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterology. 2005;128(4):833–848. doi: 10.1053/j.gastro.2005.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda AR. Variants of the 3' region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases. J Clin Microbiol. 1998;36(8):2258–2263. doi: 10.1128/jcm.36.8.2258-2263.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Yamaoka Y, Kwon DH, Graham DY. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc Natl Acad Sci USA. 2000;97(13):7533–7538. doi: 10.1073/pnas.130079797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Sugimoto M, Zali MR, Yamaoka Y. The association of vacA genotypes and Helicobacter pylori-related gastroduodenal diseases in the Middle East. Eur J Clin Microbiol Infect Dis. 2009;28(10):1227–1236. doi: 10.1007/s10096-009-0772-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ohno T, Sugimoto M, Nagashima A, Ogiwara H, Vilaichone RK, Mahachai V, Graham DY, Yamaoka Y. Relationship between Helicobacter pylori hopQ genotype and clinical outcome in Asian and Western populations. J Gastroenterol Hepatol. 2009;24(3):462–468. doi: 10.1111/j.1440-1746.2008.05762.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Yamaoka Y, Kikuchi S, el-Zimaity HM, Gutierrez O, Osato MS, Graham DY. Importance of Helicobacter pylori oipA in clinical presentation, gastric inflammation, and mucosal interleukin 8 production. Gastroenterology. 2002;123(2):414–424. doi: 10.1053/gast.2002.34781. [DOI] [PubMed] [Google Scholar]
  11. Backert S, Selbach M. Role of type IV secretion in Helicobacter pylori pathogenesis. Cell Microbiol. 2008;10(8):1573–1581. doi: 10.1111/j.1462-5822.2008.01156.x. [DOI] [PubMed] [Google Scholar]
  12. Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein. Nat Rev Cancer. 2004;4(9):688–694. doi: 10.1038/nrc1433. [DOI] [PubMed] [Google Scholar]
  13. Hatakeyama M. Helicobacter pylori CagA -- a bacterial intruder conspiring gastric carcinogenesis. Int J Cancer. 2006;119(6):1217–1223. doi: 10.1002/ijc.21831. [DOI] [PubMed] [Google Scholar]
  14. Yamaoka Y. Mechanisms of disease: Helicobacter pylori virulence factors. Nat Rev Gastroenterol Hepatol. 2010;7(11):629–641. doi: 10.1038/nrgastro.2010.154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Yamaoka Y, Kita M, Kodama T, Sawai N, Kashima K, Imanishi J. Induction of various cytokines and development of severe mucosal inflammation by cagA gene positive Helicobacter pylori strains. Gut. 1997;41(4):442–451. doi: 10.1136/gut.41.4.442. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Romo-González C, Salama NR, Burgeño-Ferreira J, Ponce-Castañeda V, Lazcano-Ponce E, Camorlinga-Ponce M, Torres J. Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes. Infect Immun. 2009;77(5):2201–2211. doi: 10.1128/IAI.01284-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Salama N, Guillemin K, McDaniel TK, Sherlock G, Tompkins L, Falkow S. A whole-genome microarray reveals genetic diversity among Helicobacter pylori strains. Proc Natl Acad Sci USA. 2000;97(26):14668–14673. doi: 10.1073/pnas.97.26.14668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gressmann H, Linz B, Ghai R, Pleissner KP, Schlapbach R, Yamaoka Y, Kraft C, Suerbaum S, Meyer TF, Achtman M. Gain and loss of multiple genes during the evolution of Helicobacter pylori. PLoS Genet. 2005;1(4):e43. doi: 10.1371/journal.pgen.0010043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Yamaoka Y, Kodama T, Kita M, Imanishi J, Kashima K, Graham D. Relationship of vacA genotypes of Helicobacter pylori to cagA status, cytotoxin production, and clinical outcome. Helicobacter. 1998;3(4):241–253. doi: 10.1046/j.1523-5378.1998.08056.x. [DOI] [PubMed] [Google Scholar]
  20. Yamaoka Y, Osato M, Sepulveda A, Gutierrez O, Figura N, Kim J, Kodama T, Kashima K, Graham D. Molecular epidemiology of Helicobacter pylori: separation of H. pylori from East Asian and non-Asian countries. Epidemiol Infect. 2000;124(1):91–96. doi: 10.1017/S0950268899003209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Yamaoka Y, El-Zimaity H, Gutierrez O, Figura N, Kim J, Kodama T, Kashima K, Graham D, Kim J. Relationship between the cagA 3' repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH. Gastroenterology. 1999;117(2):342–349. doi: 10.1053/gast.1999.0029900342. [DOI] [PubMed] [Google Scholar]
  22. van Doorn L, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, de Boer W, Quint W. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology. 1998;115(1):58–66. doi: 10.1016/S0016-5085(98)70365-8. [DOI] [PubMed] [Google Scholar]
  23. Yamaoka Y, Kodama T, Gutierrez O, Kim JG, Kashima K, Graham DY. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol. 1999;37(7):2274–2279. doi: 10.1128/jcm.37.7.2274-2279.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gancz H, Censini S, Merrell DS. Iron and pH homeostasis intersect at the level of Fur regulation in the gastric pathogen Helicobacter pylori. Infect Immun. 2006;74(1):602–614. doi: 10.1128/IAI.74.1.602-614.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, Smith DR, Noonan B, Guild BC, deJonge BL. et al. Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 1999;397(6715):176–180. doi: 10.1038/16495. [DOI] [PubMed] [Google Scholar]
  26. Ando T, Ishiguro K, Watanabe O, Miyake N, Kato T, Hibi S, Mimura S, Nakamura M, Miyahara R, Ohmiya N. et al. Restriction-modification systems may be associated with Helicobacter pylori virulence. J Gastroenterol Hepatol. 2010;25(Suppl 1):S95–98. doi: 10.1111/j.1440-1746.2009.06211.x. [DOI] [PubMed] [Google Scholar]
  27. Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill S, Dougherty BA. et al. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature. 1997;388(6642):539–547. doi: 10.1038/41483. [DOI] [PubMed] [Google Scholar]
  28. Akopyants NS, Fradkov A, Diatchenko L, Hill JE, Siebert PD, Lukyanov SA, Sverdlov ED, Berg DE. PCR-based subtractive hybridization and differences in gene content among strains of Helicobacter pylori. Proc Natl Acad Sci USA. 1998;95(22):13108–13113. doi: 10.1073/pnas.95.22.13108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kong H, Lin LF, Porter N, Stickel S, Byrd D, Posfai J, Roberts RJ. Functional analysis of putative restriction-modification system genes in the Helicobacter pylori J99 genome. Nucleic Acids Res. 2000;28(17):3216–3223. doi: 10.1093/nar/28.17.3216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. de Sablet T, Piazuelo MB, Shaffer CL, Schneider BG, Asim M, Chaturvedi R, Bravo LE, Sicinschi LA, Delgado AG, Mera RM, Phylogeographic origin of Helicobacter pylori is a determinant of gastric cancer risk. Gut. 2011. [DOI] [PMC free article] [PubMed]
  31. Vilaichone RK, Mahachai V, Tumwasorn S, Wu JY, Graham DY, Yamaoka Y. Molecular epidemiology and outcome of Helicobacter pylori infection in Thailand: a cultural cross roads. Helicobacter. 2004;9(5):453–459. doi: 10.1111/j.1083-4389.2004.00260.x. [DOI] [PubMed] [Google Scholar]
  32. Jones KR, Joo YM, Jang S, Yoo YJ, Lee HS, Chung IS, Olsen CH, Whitmire JM, Merrell DS, Cha JH. Polymorphism in the CagA EPIYA motif impacts development of gastric cancer. J Clin Microbiol. 2009;47(4):959–968. doi: 10.1128/JCM.02330-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Tsugane S, Sasazuki S. Diet and the risk of gastric cancer: review of epidemiological evidence. Gastric Cancer. 2007;10(2):75–83. doi: 10.1007/s10120-007-0420-0. [DOI] [PubMed] [Google Scholar]
  34. El-Omar E, Carrington M, Chow W, McColl K, Bream J, Young H, Herrera J, Lissowska J, Yuan C, Rothman N. et al. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 2000;404(6776):398–402. doi: 10.1038/35006081. [DOI] [PubMed] [Google Scholar]
  35. Machado JC, Pharoah P, Sousa S, Carvalho R, Oliveira C, Figueiredo C, Amorim A, Seruca R, Caldas C, Carneiro F. et al. Interleukin 1B and interleukin 1RN polymorphisms are associated with increased risk of gastric carcinoma. Gastroenterology. 2001;121(4):823–829. doi: 10.1053/gast.2001.28000. [DOI] [PubMed] [Google Scholar]
  36. El-Omar EM, Rabkin CS, Gammon MD, Vaughan TL, Risch HA, Schoenberg JB, Stanford JL, Mayne ST, Goedert J, Blot WJ. et al. Increased risk of noncardia gastric cancer associated with proinflammatory cytokine gene polymorphisms. Gastroenterology. 2003;124(5):1193–1201. doi: 10.1016/S0016-5085(03)00157-4. [DOI] [PubMed] [Google Scholar]
  37. Machado JC, Figueiredo C, Canedo P, Pharoah P, Carvalho R, Nabais S, Castro Alves C, Campos ML, Van Doorn LJ, Caldas C. et al. A proinflammatory genetic profile increases the risk for chronic atrophic gastritis and gastric carcinoma. Gastroenterology. 2003;125(2):364–371. doi: 10.1016/S0016-5085(03)00899-0. [DOI] [PubMed] [Google Scholar]
  38. Sugimoto M, Furuta T, Shirai N, Nakamura A, Xiao F, Kajimura M, Sugimura H, Hishida A. Different effects of polymorphisms of tumor necrosis factor-alpha and interleukin-1 beta on development of peptic ulcer and gastric cancer. J Gastroenterol Hepatol. 2007;22(1):51–59. doi: 10.1111/j.1440-1746.2006.04442.x. [DOI] [PubMed] [Google Scholar]
  39. Sugimoto M, Furuta T, Shirai N, Nakamura A, Kajimura M, Sugimura H, Hishida A. Effects of interleukin-10 gene polymorphism on the development of gastric cancer and peptic ulcer in Japanese subjects. J Gastroenterol Hepatol. 2007;22(9):1443–1449. doi: 10.1111/j.1440-1746.2006.04613.x. [DOI] [PubMed] [Google Scholar]
  40. Yamaoka Y. Roles of Helicobacter pylori BabA in gastroduodenal pathogenesis. World J Gastroenterol. 2008;14(27):4265–4272. doi: 10.3748/wjg.14.4265. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1

Selected 37 genes. A total of 37 genes were selected as candidate genes from two reports (Salama et al. [17] and Romo-González et al. [16]).

Click here for file (11.5KB, XLSX)

Articles from BMC Gastroenterology are provided here courtesy of BMC

RESOURCES