Table 1.
Primers used in this study
| Primer | Sequence (5' - 3') | Length | Positiona | Product size |
|---|---|---|---|---|
| EVBP-SP1-F | aaccgacatcctggcgattg | 20 | 658 | 1823 |
| EVBP-SP1-R | caaacccagtgcacgcatac | 20 | 2480 | |
| EVBP-SP2-F | cgaagcgtaatccacccttt | 20 | 679 | 1713 |
| EVBP-SP2-R | agccgtttggtaaccaagac | 20 | 2391 | |
| EVBP-FW | caccatggcagctaaagaag | 20 | 729b | 1634c |
| EVBP-RV | ttacaccatgcccatgccac | 20 | 2358 | |
a, position in the Aeromonas salmonicida chaperonin GroES and chaperonin GroEL genes, complete cds (AF030975.1); b, without 5'-cacc-3' region; c, with 5'-cacc-3' region.