Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Genomic sequence flanking the S-COMT promoter region (atg in italics). Primer sequences for the PCR amplification of bisulfite-converted DNA are Ampl Fwd: 5' TAGGAGGAGTATAGAGTATTG 3' and Ampl Rev: 5' TATCACCCATAAACAAATTATA 3'; Ext1 and Ext2 bordering CG1 and CG2 indicate the complementary extension primer sequences used in the SNuPE analysis.
