Table 1.
Real-time RT–PCR primer sequences forward reverse
| Nephrin | tggatctgatgtgaccctca | ctgggtcactgacttcagca |
| PPARγ | gatggaagaccactcgcatt | aaccattgggtcagctct |
| GAPDH | gagaggccctatcccaactc | gtgggtgcagcgaactttat |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.