Table 2. Fluorescent probes (the probes sequences have been compared by BLAST to our sequences to check their specificity and determine their mismatches).

Specificity	Probe name	Sequence (5′–3′)	Fluorescent dye	% Formamide	References
Archaea	Arch915	GTGCTCCCCCGCCAATTCCT	Cy3	10-20-30	Stahl and Amann (1991)
Eubacteria	Eub338	GCTGCCTCCCGTAGGAGT	Cy3 or Cy5 or ATTO488	10-20-30-40	Amann et al. (1990)
Alphaproteobacteria	ALF968	GGTAAGGTTCTGCGCGTT	Cy3	10-20-30-40	Manz et al. (1992)
Betaproteobacteria	BET42a	GCCTTCCCACTTCGTTT	Cy3	10-20-30-40	Manz et al. (1992)
Deltaproteobacteria	DELTA495b	AGTTAGCCGGCGCTTCCT	Cy3	10-20-30-40	Loy et al. (2002)
Gammaproteobacteria	GAM42a	GCCTTCCCACATCGTTT	Cy3	10-20-30-40	Manz et al. (1992)
Epsilonproteobacteria	EPSY549	CAGTGATTCCGAGTAACG	Cy3	20-30	Lin et al. (2006)
Bacteroidetes	CF319	TGGTCCGTGTCTGAGTAC	ATTO488	10-20-30-40	Manz et al. (1996)
Gammaproteobacteria R. exoculata cephalothoracic clones	LBl32/130	TCCTGGCTATCCCCCACTAC	ATTO488	10-20-30	Durand et al. (2010)