Table 3.
SSR primer pairs used for DNA amplification in this study with their parameters of genetic diversity of overall weedy rice (Oryza sativa f. spontanea) populations from Liaoning Province
Primer code | LO | SSR motif | Forward (5′−3′) | Reverse (5′−3′) | Na | He | Molecular weight (bp) |
---|---|---|---|---|---|---|---|
RM11 | 7 | (GA)17 | tctcctcttcccccgatc | atagcgggcgaggcttag | 7 | 0·414 | 121−147 |
RM14 | 1 | (GA)17 | ccgaggagaggagttcgac | gtgccaatttcctcgaaaaa | 3 | 0·016 | 174−191 |
RM17 | 12 | (GA)21 | tgccctgttattttcttctctc | ggtgatcctttcccatttca | 4 | 0·357 | 162−187 |
RM19 | 12 | (ATC)10 | caaaaacagagcagatgac | ctcaagatggacgccaaga | 1 | 0·000 | 216 |
RM21 | 11 | (GA)21 | acagtattccgtaggcacgg | gctccatgagggtggtagag | 10 | 0·494 | 132−160 |
RM44 | 8 | (GA)16 | acgggcaatccgaacaacc | tcgggaaaacctaccctacc | 9 | 0·713 | 100−140 |
RM55 | 3 | (GA)17 | ccgtcgccgtagtagagaag | tcccggttattttaaggcg | 5 | 0·056 | 219−238 |
RM84 | 1 | (TCT)10 | taagggtccatccacaagatg | ttgcaaatgcagctagagtac | 4 | 0·452 | 110−128 |
RM167 | 11 | GGAA(GA)16GGGG | gatccagcgtgaggaacacgt | agtccgaccacaaggtgcgttgtc | 4 | 0·549 | 124−150 |
RM180 | 7 | (ATT)10 | ctacatcggcttaggtgtagcaacacg | acttgctctacttgtggtgagggactg | 2 | 0·492 | 110−111 |
RM205 | 9 | (GA)25 | ctggttctgtatgggagcag | ctggcccttcacgtttcagtg | 2 | 0·114 | 154−156 |
RM211 | 2 | (GA)18 | ccgatctcatcaaccaactg | cttcacgaggatctcaaagg | 2 | 0·003 | 143−156 |
RM212 | 1 | (GA)24 | ccactttcagctactaccag | cacccatttgtctctcattatg | 3 | 0·010 | 118−136 |
RM215 | 9 | (GA)16 | caaaatggagcagcaagagc | tgagcacctccttctctgtag | 4 | 0·342 | 146−152 |
RM219 | 9 | (GA)17 | cgtcggatgatgtaaagcct | catatcggcattcgcctg | 7 | 0·723 | 192−214 |
RM230 | 8 | (GA)13 | gccagaccgtggatgttc | caccgcagtcacttttcaag | 3 | 0·385 | 253−257 |
RM253 | 6 | (GA)25 | tccttcaagagtgcaaaacc | gcattgtcatgtcgaagcc | 7 | 0·294 | 133−146 |
RM276 | 6 | (AG)8A3(GA)33 | ctcaacgttgacacctcgtg | tcctccatcgagcagtatca | 6 | 0·458 | 75−144 |
RM280 | 4 | (GA)16 | acacgatccactttgcgc | tgtgtcttgagcagccagg | 4 | 0·009 | 151−175 |
RM289 | 5 | G11(GA)16 | ttccatggcacacaagcc | ctgtgcacgaacttccaaag | 4 | 0·375 | 85−110 |
LO, location on chromosome number; Na, observed number of alleles; He, expected heterozygosity.