Table 2.
A list of oligonucleotides used as primers in RT-qPCR analysis of gene expression in chicken chondrocytes.
Gene symbol | RefSeq mRNA number | Forward primers | Reverse primers | Amplicon lenght | Reference | Encoded protein function |
---|---|---|---|---|---|---|
Casp3 | NM_204725.1 | TGGCCCTCTTGAACTGAAAG | TCCACTGTCTGCTTCAATACC | 139 | IDT1 | Caspase 3: apoptosis related cysteine peptidase from the group of effector caspases. |
Bak1 | NM_001030920.1 | GCCCTGCTGGGTTTCGGTAA | AATTCGGTGACGTAGCGGGC | 95 | NCBI2 | Bcl2 antagonist/killer: pro-apoptotic member of the Bcl2 family, involved in mitochondrial pore formation. |
Fas | XM_421659.2 | CCTGCTCCTCATCATTGTGT | TGATCCATGTACTCCTCTCC | 258 | [20] | Fas: TNF receptor superfamily, member 6. |
FASLG | NM_001031559.1 | GGAGAAGGAACTGGCTGAAC | GGTTTCCTGTTAAGTGTGCTG | 134 | IDT1 | Fas ligand: TNF superfamily, member 6. |
tp53 | NM_205264.1 | ACCTGCACTTACTCCCCGGT | TCTTATAGACGGCCACGGCG | 127 | NCBI2 | Tumor protein p53: tumor suppressor, activator of apoptosis through induction of BAX expression. |
AIFM1 | NM_001007490.1 | GAAGTACAACAACGGCTGAC | GAGACAGAGACAGACTTGAC | 299 | IDT1 | Apoptosis-inducing factor: pro-apoptotic mitochondrial protein, responsible for caspase-independent DNA cleavage. |
CASP8 | NM_204592.2 | GGACAGGACTGAGCTGGCGT | AGGTCCCCCACCTCGATCATC | 135 | NCBI2 | Caspase 8: apoptosis related cysteine peptidase from the group of initiator caspases. |
BCL2 | NM_205339 | GATGACCGAGTACCTGAACC | CAGGAGAAATCGAACAAAGGC | 114 | IDT1 | B-cell CLL/lymphoma 2: anti-apoptotic member of the Bcl2 family, blocks mitochondrial pore formation. |
endog | XM_415487.2 | GAACAACGTGGCCGTCCCT | GGGCATCACATAGGAGCGCA | 91 | NCBI2 | Endonuclease G: mitochondrial endonuclease, released from mitochondria during apoptosis. |
XIAP | NM_204588.1 | GCAGAATATGAGAGGCGGATAC | TCCTTCCACTCTTGCAATCC | 149 | IDT1 | X-linked inhibitor of apoptosis: anti-apoptotic protein from the IAP family, blocks caspase 3 activation by inhibiting caspase 9. |
NOS2 | NM_204961.1 | GCATTCTTATTGGCCCAGGA | CATAGAGACGCTGCTGCCAG | 66 | IDT1 | Nitric oxide synthase 2, inducible: pleiotropic immune system regulator, inducer of apoptosis in chondrocytes. |
NFκB1 | NM_205134.1 | AGGACTTAAAATGGCAGGAGAG | GCTGTTCGTAGTGGTAAGTCTG | 141 | IDT1 | Nuclear factor of kappa light polypeptide gene enhancer in B-cells 1: transcription factor with pro- or anti-apoptotic functions. |
CD44 | NM_204860.2 | AGCACTGGTCTTTACTGGAAC | TCTGAGCAACTTGGGAAACTG | 93 | IDT1 | CD44 molecule (Indian blood group): hyaluronan receptor, involved in interaction of the cell with the extracellular matrix, capable of inducing caspase-independent death via calpain-dependent AIF release. Crosslinking of CD44 augments Fas expression and mRNA transcription. |
htrA3 | XM_420813.2 | CCTCCCGCGGCTTCGTATTC | TGCAGTCGCGGTGCAGTAAG | 116 | NCBI2 | HtrA serine peptidase 3: mitochondrial serine peptidase, inhibits XIAP. |
Mapk11 (p38B) | NM_001006227.1 | GCGGCTCCGCTAAAATGCCG | GGGGTGAGGTTCTGGTAGCGC | 97 | NCBI2 | Mitogen-activated protein kinase 11: stimulates caspase 3 activity, NFκB expression and p53 expression and protein stability. |
GAPDH | NM_204305.1 | ATGGCATCCAAGGAGTGAGC | AACAAAGGGTCCTGCTTCCC | 66 | [39] | Glyceraldehide-3-phosphate dehydrogenase: enzyme in carbohydrate metabolism. |
1 Designed in Integrated DNA Technologies PrimerQuestSM application 2 Designed in NCBI Primer-BLAST application