Table 2. Characteristics of the five MHC-linked microsatellites loci analyzed in this study.

Class	Locus	Primer sequences	Closest gene	Repeat	Total number of alleles per locus	Number of alleles per ind.
		(primer reference or design method)	(distance)		(size range)
I	D20Rat21	5′-CTGTGCTATGGCAGGAGATT-3′	RT1-M6 (500 bp)	TG and AG	42	2–6
		5′-GCCATCTTCAGCACTACAGG-3′			(289–359)
		(Design on R. norvegicus genome)
	RT1N1	5′-TCTCGTGGAATAGGCAGA-3′	RT1N1 (1500 bp)	AG	16	1–4
		5′-TGGCTGTCCTAGAACTCACT-3′			(302–375)
		(Design on R. rattus sequences)
	D20Img2	5′-CTGAGCTCCCTAGGACCTACAT-3′	Ddr1 (42000 bp)	CA	7	1–2
		5′-TCTCTTGTGTCAGGCTAATTAC-3′			(277–333)
		[60]
III	Msat-Tnf	5′-ACATAGGCATGGTGTCTCTG-3′	Tnf (300 bp)	CA	16	1–2
		5′-CAGGATTCTGTGGCAATCTG-3′			(147–180)
		(Design on R. rattus sequences)
II	D20Rat41	5′-AGTYCTCTTCTGGYCTCCAT -3′	RT1-Bb (4 400 bp)	TG	42	1–4
		5′- TGGGACGATGTGTCATATCC -3′			(162–220)
		(Design on R. rattus sequences)

The five loci are ranked as on the chromosome, with D20Rat21 the closest to the telomere.

The neighboring genes indicated are based on the R. norvegicus genome sequence.