Table. Oligonucleotide primers designed and used for PCR amplification and sequencing of Bordetella pertussis, China*.
Primer | Sequence, 5′ → 3′ | Gene | Position |
---|---|---|---|
prn-1F | ATGTCTCTGTCACGCATTGTCA | prn | 151–172 |
prn-1R | GTCCTGCATGACGACCAGCTTG | prn | 1653–1632 |
prn-2F | CTCGAACGTCGGTGCGCTAC | prn | 1479–1498 |
prn-2R | TCGCGTCCAGGTAGAAACCG | prn | 2347–2328 |
ptxA-F | GGCACCATCAAAACGCAGAGGGG | ptxA | 476–498 |
ptxA-R | ATTACCGGAGTTGGGCGGGGCTG | ptxA | 1347–1325 |
fim2-F | ACCCATGCAAATCCCTTTCCAACGC | fim2 | 177–201 |
fim2-R | GGGGGTTGGCGATTTCCAGTTTCTC | fim2 | 877–853 |
fim3-F | ATGTCCAAGTTTTCATACCCTGCCT | fim3 | 336–360 |
fim3-R | TTCGTCTCCTGACGCCGCGTAGCGG | fim3 | 1033–1009 |
tcfA-1F | CCACATTGATTCAGGCCGCT | tcfA | 251–270 |
tcfA-1R | CGTCCGCAGGAGACTTGGAA | tcfA | 1096–1077 |
tcfA-2F | GACTCCGGTATGTCCGATTC | tcfA | 976–995 |
tcfA-2R | CTACCAGGCGTAGCGATAGC | tcfA | 2346–2327 |
*Primer positions are listed according to the numbering of the sequences of the following GenBank accession nos.: ptxA, M13223; prn, J04560; fim2, Y00527; fim3, X51543; and tcfA, U16754. prn, pertactin; ptx, pertussis toxin; fim, fimbriae; tcf, tracheal colonization factor.