Table 1.
Primer or probe | Sequence (5′-3′) | Target in assay | Position in reference sequence |
---|---|---|---|
Primers | |||
Babesia 8 forward | CAGGGAGGTAGTGACAAGAAATAACA | B. microti DNA and both control plasmids | 417–442 |
Babesia 8 reverse | GGTTTAGATTCCCATCATTCCAAT | B. microti DNA and both control plasmids | 465–488 |
Probes | |||
Babesia microti 8 | 6FAM-TACAGGGCTTAAAGTCT-MGBNFQ | B. microti DNA, genomic and plasmid | 444–461 |
BBIC | VIC-CTACAACTTCAACAGCTCGTA-MGBNFQ | Bicoid plasmid | 2971–2992 |
The full sequence of the inhibition control insert was as follows: CAGGGAGGTAGTGACAAGAAATAACACTGTCGCGTCCTGGTCAAGGACGAACCGGAGGCCGACTACAACTTCAACAGCTCGTACTACATGCGATCGGGAATGTCTGGCGCCACTGCATCGGCATCCGCTGTGGCCCGAGGCGCTGCCTCGCCGGGCTCCGAGGTCTACGAGCCATTAACACCCAAGAATGACGAAAGTCCGAGTCTGATTGGAATGATGGGAATCTAAACC. This insert was constructed by amplifying bicoid DNA with chimeric forward and reverse primers. Underlining indicates the sequence corresponding to the Babesia primers used in this assay, and boldfacing indicates the 5′ and 3′ termini of the bicoid sequence. The italics indicate the position of the bicoid probe.