Table 1. Target SNP positions, primer information and predicted melting curves.

Gene	Target SNP	Primer name	Primer position	Sequence (5′-3′)	Amplicon length (bp)	Melting curves
infB	729	infB729-F	696–711	CCTGCCGGAAGAGTGG	50	12, 13
		infB729-R	730–745	TCGCGGAAACGTGGAC
mdh	1197	mdh1197-F	1159–1178	ATTGCCGACCTGACTAAACG	58	8, 9, 10
		mdh1197 R	1198–1216	CTTTCGCTTCCACGACTTC
phoE	2013	phoE2013-F	1996–2012	GAAGGGGTGGGGAGTGA	78	18, 19, 20, 21
		phoE2013-R	2054–2073	GGCGTTCATGTTTTTGTTGA
rpoB	2227	rpoB2227-F	2153–2173	TGATTAACTCCCTGTCCGTGT	132	41, 42, 43, 44, 45, 46, 47
		rpoB2227-R	2263–2284	CGTAGTTGCCTTCTTCGATAGC
tonB	2693	tonB2693-F	2659–2677	GTTGAACCCGAACCTGAGC	101	36, 38, 39, 40, 41, 42, 45
		tonB2693-R	2742–2759	GGTTTGGGCTTCGGCTTA
tonB	2886	tonB2886-F	2783–2802	AAAAGGTTGAACAGCCGAAG	120	49, 50, 54, 55, 56, 57, 58, 59
		tonB2886-R	2887–2902	CCGCTGCTGTCGAGGT

All positions are relative to the concatenated MLST sequence. The far right column describes the theoretically possible melting curves for the 6MelT system as predicted by HRMType and named according to the number of G+C residues in the alleles.