Table 2.
Specific infectivity of CVB3 is greatly reduced compared to that of PV after ribavirin treatment
| Virus | RBV (μM) | Titer ± SDa (PFU/ml) | No. of virions/ml ± SDb | Fecundityc (no. of virions/cell ± SD) | Specific infectivity ± SDc (× 10−2 PFU/genome) |
|---|---|---|---|---|---|
| PV | 0 | 1.7 × 108 ± 3.1 × 107 | 1.3 × 1010 ± 4.8 × 109 | 4.5 × 104 ± 1.7 × 104 | 1.5 ± 0.84 |
| PV | 200 | 4.0 × 106 ± 9.5 × 105 | 7.8 × 108 ± 6.5 × 107 | 2.8 × 103 ± 2.3 × 102 | 0.51 ± 0.091 |
| PV | 400 | 5.0 × 105 ± 1.4 × 105 | 4.0 × 108 ± 3.2 × 108 | 1.4 × 103 ± 1.1 × 103 | 0.24 ± 0.26 |
| CVB3 | 0 | 4.6 × 107 ± 3.1 × 107 | 4.6 × 109 ± 2.8 × 109 | 1.6 × 104 ± 9.8 × 103 (ns) | 1.2 ± 0.79 (ns) |
| CVB3 | 200 | 1.3 × 105 ± 6.1 × 104 | 2.8 × 108 ± 1.4 × 108 | 9.7 × 102 ± 5.1 × 102 (P < 0.01) | 0.054 ± 0.027 (P < 0.001) |
| CVB3 | 400 | 4.8 × 103 ± 1.7 × 103 | 3.5 × 108 ± 4.1 × 108 | 1.2 × 103 ± 1.4 × 103 (ns) | 0.0035 ± 0.0.0038 (P < 0.05) |
a
Titers were determined by a standard plaque assay using HeLa cells.
b
Numbers of virions per milliliter were determined by qRT-PCR using virion RNA and the following primers and probes: for CVB3, the forward primer was GATCGCATATGGTGATGATGTGA, the reverse primer was AGCTTCAGCGAGTAAAGATGCA, and the 6-carboxyfluorescein (FAM) probe was CGCATCGTACCCATGG; and for PV, the forward primer was CCCGTCCAAAACCAAGCTT, the reverse primer was CCTTCACCCCTTCAAACACATAG, and the FAM probe was ACCCAGTGCTTTCC.
c
Statistical significance was determined by a two-tailed unpaired t test; n = 3.