Table 1.
Oligonucleotide primer sequences used in RT-PCR
Mouse Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
12/15-LO* | ctctcaaggcctgttcagga | gtccattgtccccagaacct |
Actin | aggtcatcactattggcaacga | ccctccatgatggaattgaatgtagtt |
BiP | ttcagccaattatcagcaaactct | ttttctgatgtatcctcttcaccagt |
CHOP | ccaccacacctgaaagcagaa | aggtgaaaggcagggactca |
WFS1 | ccatcaacatgctcccgttc | gggtaggcctcgccataca |
XBP-1 total | tggccgggtctgctgagtccg | gtccatgggaagatgttctgg |
XBP-1 spliced | ctgagtccgaatcaggtgcag | gtccatgggaagatgttctgg |
12/15-LO, 12/15-lipoxygenase; BiP, binding immunoglobulin protein; CHOP, CCAAT/enhancer-binding protein homologous protein; WFS1, Wolfram syndrome 1; XBP-1, X-box protein-1.
For amplification of 12/15-LO, the cycling conditions were 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, followed by 81°C for 15 s.