Skip to main content
. 2012 Jan 3;302(6):E654–E665. doi: 10.1152/ajpendo.00373.2011

Table 1.

Oligonucleotide primer sequences used in RT-PCR

Mouse Genes Forward Primer (5′-3′) Reverse Primer (5′-3′)
12/15-LO* ctctcaaggcctgttcagga gtccattgtccccagaacct
Actin aggtcatcactattggcaacga ccctccatgatggaattgaatgtagtt
BiP ttcagccaattatcagcaaactct ttttctgatgtatcctcttcaccagt
CHOP ccaccacacctgaaagcagaa aggtgaaaggcagggactca
WFS1 ccatcaacatgctcccgttc gggtaggcctcgccataca
XBP-1 total tggccgggtctgctgagtccg gtccatgggaagatgttctgg
XBP-1 spliced ctgagtccgaatcaggtgcag gtccatgggaagatgttctgg

12/15-LO, 12/15-lipoxygenase; BiP, binding immunoglobulin protein; CHOP, CCAAT/enhancer-binding protein homologous protein; WFS1, Wolfram syndrome 1; XBP-1, X-box protein-1.

*

For amplification of 12/15-LO, the cycling conditions were 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, followed by 81°C for 15 s.

HHS Vulnerability Disclosure