Table 2. Primers and probes employed for genotyping three promoter SNPs in the FCN2 gene.

Position	Primer/Probe	Sequence
−986G>A	Primers	5′-tgatcttgccaaggaagaaggc-3′
		5′- ccactaccaccaccgca -3′
	Probes	5′-YAK-acctgccgccatcgg- BBQ3
		5′ -FAM-acctgctgccatcggga- BBQ3′
−602G>A	Primers	5′-tccccactcttctctcctttcc-3′
		5′-cctggggcagtatgtagagca-3′
	Probes	5′-YAK-tcctgttcgtgtgcccc-BBQ3′
		5′-FAM-tcctgttcatgtgcccctg-BBQ3′
−4A>G	Primers	5′- aagatgagaaattggagtctgaggga- 3′
		5′-gaaagagagcagcagggtgg-3′
	Probes	5′-YAK- ctccatctcctctggtctttgctt - BBQ3′
		5′-FAM- agctccatctcttctggtctttgc - BBQ3′

YAK and FAM are the reporter fluorophores Yakima Yellow and Fluorescein, respectively.

Each probe carries at the 3′-end the dark BBQ (BlackBerry Quencher).