Skip to main content
. Author manuscript; available in PMC: 2012 Mar 24.
Published in final edited form as: Methods Mol Biol. 2011;780:277–291. doi: 10.1007/978-1-61779-270-0_17

Fig. 3.

Fig. 3

A pyrogram of a tumor DNA showing heterogeneous levels of methylation at 4 CG sites in the CpG island of the BRCA1 gene promoter (nt 1539–1563 Genbank U37574). The y-axis represents the signal intensity in arbitrary units, the x-axis shows the dispensation sequence. The sequence reads 3' CGCGCTTTTCCGTTACCACGAAAAC 5'