TABLE 1 .
Mycobacteriophages, bacterial strains, plasmids, and oligonucleotides used in this study
| Mycobacteriophage, plasmid, strain, or oligonucleotide |
Description or sequence | Reference |
|---|---|---|
| Mycobacteriophage | ||
| phAE142 | Mycobacteriophage TM4-based luciferase reporter phage | 5 |
| phSP6-ProPol | Prototype SGM phage | This study |
| Plasmids | ||
| phMM-001 | Ampr phasmid derived from phAE142; maintained in E. coli | This study |
| pYUB-Bss | Ampr low-copy-number targeting vector encoding E. coli origin of replication and Pleft promoter-driven luciferase gene; derived from BssHII fragment of phMM-001 |
This study |
| pUC57-SP6-ProPol | Ampr high-copy-number E. coli plasmid containing SGM | This study |
| pSP6-ProPol | SGM from pUC57-SP6-ProPol inserted into pYUB-Bss in place of Pleft promoter and luciferase gene |
This study |
| pSP6-ProPol-Kan | pSP6-ProPol with Ampr gene replaced with Kanr gene | This study |
| Bacterial strains | ||
| DH5α | E. coli cloning strain | 23 |
| DH10B | E. coli cloning strain | 24 |
| mc2 4502 |
M. smegmatis strain constitutively expressing mycobacteriophage L5 gp71 polypeptide to downregulate Pleft promoter activity during growth of reporter phage stocks |
5 |
| RIFr M. tuberculosis strain | Rifampin-resistant H37Rv derivative generated at Sequella, Inc. | Unpublished |
| EMBr M. tuberculosis strain | Ethambutol-resistant H37Rv derivative generated at Sequella, Inc. | Unpublished |
| Oligonucleotides | ||
| UL53-DnSt-113348 | 5′ GACCCATGGGCGGGGTCGTT 3′ | This study |
| UL53-UpSt-112112 | 5′ AGTGCTTTGCCGCCAAATGC 3′ | This study |
| PLLF | 5′ GTGGCTGTCAAGCCCTAATC 3′ | This study |
| TM450133-52 | 5′ GTGTCGTGCTCGGTAACCTC 3′ | This study |