Fig 1.
Genetic organization of the wbk locus of B. abortus 2308. (A) wbk locus (white arrows represent ORFs encoding LPS biosynthesis genes, gray triangles show transposase ORFs, a white triangle represents a gene encoding a putative regulatory protein, and the black bar indicates a gene encoding a tRNAGln). (B) wbkA region. Small gray boxes indicate the 60-nt repeat sequences located upstream of each ISBm1 (the sequences are AAAATTTTTTGGCATTTATCGGCCGCTATGATTCAAGGCTTCGAAATAGGGGAGCCTTTG and AAAATTTCTTGGCATTTATCGGCCGCTATGTTCAAGGCTTCGAAATAGGGAAGTCTTTG for left and right ISBm1 copies, respectively). The primer positions are depicted by small black arrows (P1, BAB1_0545Fb; P2, BAB1_0558R; P3, BAB1_0548R; P4, BAB1_0557F). The AvaI-ClaI segment indicates the location of the corresponding IS711-carrying 3.8-kb restriction fragment. The IS711 element is indicated in black. (C) Flanking ISBm1 with their corresponding inverted repeats (in boldface; polymorphism is indicated in gray).