Table 3. Oligonucleotides.
| Msi2 shRNA | Clone ID | Mature sense sequence |
| Msi2 shRNA #1 | TRCN0000071973 | CCCAGCTTAATATCTAGTTAA |
| Msi2 shRNA #4 | TRCN0000071976 | GCTACAGTGCTCAACCGAATT |
| Msi2 shRNA #5 | TRCN0000071977 | CCACCATGAGTTAGATTCCAA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.