Skip to main content
. 2004 Sep;10(9):1661–1664. doi: 10.3201/eid1009.040236

Table. Descriptive statistics for IGSa and p66 loci of three Borrelia species.

Species Locus No. samples No. variants Aligned characters
Base pairs No. gapped Polymorphisms (%) πb
Borrelia miyamotoi s.l. IGS 33 4 474 15c 40 (8.4) 0.058
p66 d 19 3 617 9 38 (6.2) 0.042
B. lonestari IGS 20 3 412 1 14 (3.4) 0.023
p66 e 7 3 346 0 5 (1.4) 0.010
B. hermsii IGS 9 4 665 2 20 (3.0) 0.015
p66 e 5 3 516 3 8 (1.6) 0.010

aIGS, 16S-23S rRNA gene intergenic spacer region.
bπ, mean nucleotide diversity at each aligned position.
cExcludes an 81-bp indel.
dPartial p66 genes were amplified by nested PCR with outer forward and reverse primers of 5´GATTTTTCTATATTTGGACACAT and 5´AATTTAATCAGATTGTTTAGCTCTA and inner primers of 5´GACACATATCTAAAAAAGCAAACAC and 5´CTAATCCGGTTTTTACGTATATGC and following conditions: 40 cycles of 94°C for 60 s, 55°C for 120 s, and 74°C for 120 s. GenBank accession numbers for p66 genotypes are the following: B. miyamotoi s.l. type 1 (AY363722), type 2 (AY363723), type 3 (AY363724); B. lonestari type 1 (AY363689), type 2 (AY363690), type 3 (AY363691); B. hermsii type 1 (AF016408), type 2 (AF228028), and type 4 (AF116905).
eAnalysis of B. lonestari and B. hermsii p66 fragments was limited to 346 of 605 bp and 516 of 608 bp, respectively, which corresponded to the shortest sequences available for all types of the individual species.