Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of the miRNA primers used in quantitative real time PCR analysis in compression wood and tension wood of 2 years old A. mangium.
| Sequence ID | Sequence ( 5’ ➙ 3’ ) | miRNA family |
|---|---|---|
| 87(21) | TTTGGATTGAAGGGAGCTCTA | amg-miR159 |
| 4(21) | TCGCTTGGTGCAGGTCGGGAA | amg-miR168 |
| 10(21) | AGAATCTTGATGATGCTGCAG | amg-miR172 |
| 622(21) | TTGGCATTCTGTCCACCTCCC | amg-miR394 |
