Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for detection of HOXA10 mRNA and miR-135a by RT-PCR
| Primers | Sequence |
|---|---|
| miR-135 RF | cgcgtctatggctttttattccta |
| anchor RT primer | cgactcgatccagtctcagggtccgaggtattcgatcgagtcgcactttttttttttt |
| Universal rev primer | ccagtctcagggtccgaggtattc |
| U6F | ctcgcttcggcagcaca |
| U6T | aacgcttcacgaatttgcgt |
| HOXA10 RT F | ctggtcccctccctctgtc |
| HOXA10 RT T | acaacaaataaaccagcaccaag |
| β-actin F | ccttcctgggcatggagtcct |
| β-actin T | aatctcatcttgttttctgcg |
