| Reference | Type | Start | Stop | Strand | Length | Structure | Sequence |
|---|---|---|---|---|---|---|---|
| BA Ames | Direct Repeat | 40529 | 40551 | + | 23 | 10-3-10 | ATTCGAGGAATTTATTCGAGGAA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.