. Author manuscript; available in PMC: 2012 May 16.

Published in final edited form as: J Infect Dis. 2009 May 1;199(9):1275–1285. doi: 10.1086/597808

Table 1.

Oligonucleotide primers used for polymerase chain reaction (PCR) amplification and ultra-deep pyrosequencing (UDPS) of hepatitis B virus reverse-transcriptase (RT) genes.

Process, primer	Sequence (5’→3’)	Direction	pol nucleotides^a	RT amino acids^a
Amplification and direct PCR sequencing
Pol1	TTCCTGCTGGTGGCTCCAGTTC	Forward	55 → 75	−25 → −18
Pol2	GGAGTTCCGCAGTATGGATCGG	Reverse	1261 ← 1282	+33 ← +40
Pol3	GGCTCAGTTTACTAGTGCCATTTGT	Forward	668 → 693	180 → 188
Pol4	GCCCCCAATACCACATCATC	Reverse	743 ← 761	211 ← 222
UDPS^b
F1	CTGCTGGTGGCTCCAGTT	Forward	57 → 74	−24 → −18
R1	TGAGGCATAGCAGCAGGATG	Reverse	409 ← 428	94 ← 100
F2	TGGATGTGTCTGCGGCGTTT	Forward	374 → 393	82 → 88
R2	TGYACAGAYTTGGCCCCCAA	Reverse	754 ← 773	209 ← 215
F3	CTTTCCCCCACTGTYTGGC	Forward	710 → 728	194 → 200
R3	TTGGCGAGAAAGTRAAAGCCTG	Reverse	1084 ← 1105	319 ← 325
F4	CCWATTGATTGGAAAGTNTGTCA	Forward	970 → 993	281 → 288
R4	AGGAGTTCCGCAGTATGGAT	Reverse	1264 ← 1283	+34 ← +40

Numbering is based on the genotype D strain ayw genome, GenBank accession number J02203 [9]. The − and + symbols indicate 3’ and 5’ positions, respectively, relative to the RT gene.

Each primer also contained 1 of 2 adaptor sequences (454 Life Sciences). Forward primers were tailed with the adaptor A sequence (5’-GCCTCCCTCGCGCCATCAG-3’) and reverse primers were tailed with the adaptor B sequence (5’-GCCTTGCCAGCCCGCTCAG-3’). One of 4 distinct 3-nucleotide bar codes (AAT, TTA, ACT, and CGT) was synthesized between the adaptor sequence and the primer sequence.