Table 2.

 Mutation‐specific quantitative PCR primers and probes

Mutation	PCR primers	TaqMan probes (6FAM‐labeled)	PCR conditions
G250E	F: 5′‐ATGGAACGCACGGACATCA‐3′ R: 5′‐TCTTCCACACGCCCTCGTA‐3′	Unmutated probe: 5′‐6FAM‐GTACTGGCCCCCGCCCAGCTT‐MGB‐3′ Mutant probe:† 5′‐6FAM‐GTACTGGCCCTCGCCCAGCTT‐MGB‐3′	Start: 50°C 2 min/95°C 10 min Step 1: 95°C 30 s Step 2: 68°C 30 s Step 3: 72°C 30 s 40 cycles
T315I	F: 5′‐TCTGCACCCGGGAGCCCCCGT‐3′ R: 5′‐AGTCCAGGAGGTTCCCGTAGG‐3′	Unmutated probe: 5′‐6FAM‐ATCATCACTGAGTTC‐MGB‐3′ Mutant probe:† 5′‐6FAM‐ATCATCATTGAGTTC‐MGB‐3′	Start: 95°C 10 min Step 1: 95°C 15 s Step 2: 58°C 30 s 40 cycles
M351T	F: 5′‐TGCTGTACATGGCCACTCAGA‐3′ R: 5′‐TGTGGATGAAGTTTTTCTTCTC‐3′	Unmutated probe: 5′‐6FAM‐GTACTCCATGGCTGA‐MGB‐3′ Mutant probe:† 5′‐6FAM‐GTACTCCGTGGCTGA‐MGB‐3′	Start: 50°C 2 min/95°C 10 min Step 1: 95°C 30 s Step 2: 61°C 30 s Step 3: 72°C 30 s 40 cycles

†These probes can also be labeled with VIC for multiplex detection with unmutated sequence in the same well. 6FAM, 6‐carboxyfluorescein. The nucleotide that is different in mutant probe as compared with unmutated probe is highlighted in bold.