Table 2.

Thermodynamic parameters for specific EcoRI binding at 25°C^a

	Wild type		A138T
	Multiparametric fitb	Clarke and Glewc	Multiparametric fitb	Clarke and Glewc
ΔG° (kcal/mol)	−13.1 ± 0.1	−13.0 ± 0.01	−14.6 ± 0.1	−14.6 ± 0.02
ΔH° (kcal/mol)	−15.4 ± 0.4	−15.1 ± 0.5	−12.8 ± 0.3	−12.9 ± 0.6
TΔS° (kcal/mol)	−2.3 ± 0.2	−2.1 ± 0.5	1.8 ± 0.3	1.7 ± 0.6
ΔC°p (kcal/mol•K)	−1.8 ± 0.1	−1.9 ± 0.1	−1.90 ± 0.1	−1.9 ± 0.1
dΔC°p/dT (kcal/mol•K2)	-	−0.01 ± 0.04	-	0.0 ± 0.02
ΔΔG° (kcal/mol)d	0	0	−1.5 ± 0.1	−1.6 ± 0.1
ΔΔH° (kcal/mol)	0	0	2.6 ± 0.5	2.2 ± 0.8
Δ(TΔS°) (kcal/mol)	0	0	4.1 ± 0.4	3.8 ± 0.8
ΔΔC°p (kcal/mol•K)	0	0	−0.1 ± 0.1	0.0 ± 0.1
Δ(dΔC°p/dT) (kcal/mol•K2)	-	0	-	0.01 ± 0.03

^aEquilibrium association constants (K_A) were measured as a function of temperature in 10mM cacodylate, 0.27M KCl, pH 7.3, using the oligonucleotide: 5'GGGCGGGCGCGAATTCGCGGGCGC (specific recognition sequence underlined).

^bSee Experimental Procedures

^cSee Experimental Procedures

^dAll difference parameters (e.g., ΔΔG°) are referenced to the wild-type.