Table 1. Rabbit primer pairs for quantitative RT-PCR analysis.
| Rabbit target gene | Forward and reverse primer sequences | Primer location within CDS | Target size | NCBI Accession # |
| Control gene | ||||
| GAPDH | PS182:TGACGACATCAAGAAGGTGGTG; PS183:GAAGGTGGAGGAGTGGGTGTC | Exon 1 of 1 | 120 nts | NM_001082253 |
| Cytokines & Chemokines | ||||
| CCL4 | PS343:GAGACCACCAGCCTCTGCTC; PS344:TCAGTTCAGTTCCAAGTCATCCAC | Exon 2 and 3 from 3 | 123 nts | NM_001082196 |
| CCL20 | PS565:TATCGTGGGCTTCACACAGC; PS566:CCATTCCTTCTTCGGATCTGC | Exon 2 and 3 from UD | 115 nts | Trace Archive |
| IFN-β | PS291:TCCAACTATGGCACGGAAGTCT; PS292:TTCTGGAGCTGTTGTGGTTCCT | Exon 1 from 1 | 133 nts | XM_002707968 |
| IFN-γ | PS186:TGCCAGGACACACTAACCAGAG; PS187:TGTCACTCTCCTCTTTCCAATTCC | Exon 1 and 2/3 from 4 | 127 nts | NM_001081991 |
| IL-1β | PS168:TTGAAGAAGAACCCGTCCTCTG; PS169:CTCATACGTGCCAGACAACACC | Exon 3/4 and 4 from∼6 | 128 nts | NM_001082201 |
| IL-2 | PS275:GCCCAAGAAGGTCACAGAATTG; PS276:TGCTGATTGATTCTCTGGTATTTCC | Exon 2/3 and 3 from 4 | 128 nts | NM_001163180 |
| IL-4 | PS267:CGACATCATCCTACCCGAAGTC; PS268:CCTCTCTCTCGGTTGTGTTCTTG | Exon 1 and 2/3 from 4 | 122 nts | NM_001163177 |
| IL-6 | PS170:CTACCGCTTTCCCCACTTCAG; PS171:TCCTCAGCTCCTTGATGGTCTC | Exon 2 from ∼5 | 135 nts | NM_001082064 |
| IL-8 | PS287:CCACACCTTTCCATCCCAAAT; PS288:CTTCTGCACCCACTTTTCCTTG | Exon 2 and 3 from 4 | 122 nts | NM_001082293 |
| IL-10 | PS281:CTTTGGCAGGGTGAAGACTTTC; PS282:AACTGGATCATCTCCGACAAGG | Exon 1 and 3 from 5 | 126 nts | NM_001082045 |
| IL-12p35 | PS214:AAGGCCAGACAAACTCTAGAATTC; PS215:TTGGTTAACTCCAGTGGTAAACAGG | Exon 3/4 and 4/5 from ∼8 | 116 nts | XM_002716291 |
| IL-12/IL-23p40 | PS211:CTCCGAAGAAGATGGCATTACC; PS212:TCTCCTTTGTGGCAGGTGTATTG | Exon 2 from 6 | 126 nts | XM_002710347 |
| IL-17A | PS591:CCAGCAAGAGATCCTGGTCCTA; PS592:ATGGATGATGGGGGTTACACAG | Exon 3 from 3 | 112 nts | XM_002714498 |
| IL-17F | PS589:AAAATCCCAAAGTGGAGGATGC; PS590:AGCGGTTCTGGAAGTCATGTGT | Exon 2 from 3 | 138 nts | XM_002714499 |
| IL-18 | PS575:ACCAAGGACAGCAACCTGTGTT; PS576:ACAGAGAGGCTTACAGCCATGC | Exon 3 and 4 from 5 | 120 nts | NM_001122940 |
| IL-21 | PS579:GCTGGCAACATGGAAAGGATAG; PS580:TTGCCCTTTGGAGCTTGATTTA | Exon 4 from 8 | 84 nts | XM_002717257 |
| IL-22 | PS567:ACCTCACCTTCATGCTGGCTAA; PS568:CATGGAACAGCTCATTCCCAAT | Exon 1 and 2 from 5 | 84 nts | XM_002711248 |
| TGF-β | PS199:CAGTGGAAAGACCCCACATCTC; PS200GACGCAGGCAGCAATTATCC | Exon 6 and 7 from ∼8 | 140 nts | NM_001082660 |
| TNF-α | PS174:CTGCACTTCAGGGTGATCG;PS175:CTACGTGGGCTAGAGGCTTG | Exon 1 and 3 from ∼4 | 133 nts | NM_001082263 |
| Antimicrobials | ||||
| CAP-18 | PS176:CCCAAGAGTCCCCAGAACCTAC; PS177:TCTGTCCTGGGTGCAAGTTTC | Exon 3/4 and 4 from ∼4 | 130 nts | NM_001082305 |
| LeukoP | PS225:GTCGCCGTCTGAGATATGAGGA; PS226:GTTGAGTGGGATCCTGGATTTG | Exon 1 and 2 from 2 | 140 nts | NM_001082325 |
| NP3α | PS205:ACCTTACAGGGGAGGAAAGCTC; PS206:GTACATAGCGGGCTCCATTGAC | Exon 1 and 2 from 2 | 132 nts | NM_001082298 |
| Enzymes | ||||
| COX-2 | PS329:CGGATTCTACGGTGAAAACTGC; PS330:GACGATGTTCCAGACTCCCTTG | Exon 1 and 2 from 10 | 124 nts | NM_001082388 |
| iNOS | PS573:GACGTCCAGCGCTACAATATCC; PS374:GATCTCTGTGACGGCCTGATCT | Undetermined | 102 nts | XM_002718780 |
Rabbit primer pairs were designed within the coding sequence (CDS) of rabbit genes identified either by homology to the mouse or human gene using the NCBI rabbit.
Trace Archive database, or predicted or experimentally-determined CDSs available at NCBI. All primers were designed using identical design parameters (see Materials and Methods) and made to span exon junctions when possible.
CAP: cationic animicrobial protien (a cathelicidin (LL-37 in humans); CCL: cheomokine (C-C motif) ligand; COX: cyclo-oxygenase; iNOS: inducible Nitric oxide synthase; IFN: Interferon; IL: Interleukin; LeukoP: Leukocyte protein (cationic antimicrobial peptide); NP: Neutrophil protein (a defensin); TGF: Transforming growth factor.