Table 1.
Sequences of the primers and probes used in this study
Primer or probe | Sequencea | Locationb |
---|---|---|
Primers | ||
AgD-F1 | 5′CGGGCCGGCTGTTCTTCT3′ | 1158–1175 |
AgD-F2 | 5′CGGGCCGGCTACTCTTCT3′ | 1158–1175 |
AgD-R | 5′AAGGAAGGCCCTCGAGAACA3′ | 1287–1268 |
Probes | ||
TaqMan-MGB | 5′CTCTTCTTCCTCCYTGCTGA3′ | 1215–1234 |
LNA-BHQc | 5′CTTCTTCCTCCYTGCTGA3′ | 1217–1234 |
dLy86 | 5′CTCTTCCTCCTCCGCGCTGA3′ | 1215–1234 |
dLy20 | 5′CTCTTCTTCTTCCTTGCTCA3′ | 1215–1234 |
dLy131 | 5′CTCTTCCTCTTCCTTGCTGA3′ | 1215–1234 |
TaqMan-MGB and LNA-BHQ probe sequences were aligned with patients' sequences correctly detected by the LNA-BHQ probe but not by the TaqMan-MGB probe. Boldface letters in the two forward primer sequences indicate differences. Boldface letters in the probe sequences show the differences between the probe and patient sequences.
Numbering refers to the HDV-1 genome (accession number M21012).
LNA nucleotides are underlined.